Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0001299

Physical Location & Seq

Genomic Coordinates Forward (+)

32095747 .. 32096585

Gene Structure 839 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G341600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

ATGGATCGCTCCATCCGCCTTGTCTCAGCTGCCTTCGTTCTTGTCCTGCTTTTGGTGGCTGCCGAGATGGGACCAATGGCTGTGGAGGGAAGGGACGCTAAGAAGGTTGAGCCAAAGAAGAAGACATGTGATTCTCAGAGCCAAAAATTCAAGGGGATGTGCTTTTTGACAAGTAGCTGTGTGCAATCTTGCAAATCAGAGGGCTTCACCGGAGGCCAATGCCGCGGTTTCCGCCGCAGATGCTTTTGCTCCAAAAATTGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Gamma-thionin

Protein Analysis

88

Amino Acids

9.58

Weight (kDa)

9.46

Isoelectric Point (pI)

54.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001299)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G31953 AT2G31957
fragaria_vesca	FvH4_1g21320 FvH4_6g22740
malus_domestica	MD02G1207600.v1.1 MD11G1108400.v1.1 MD11G1108800.v1.1 MD11G1113600.v1.1 MD12G1061400.v1.1 MD12G1061700.v1.1 MD12G1121400.v1.1 MD13G1011400.v1.1 MD13G1011500.v1.1 MD13G1011600.v1.1 MD13G1011700.v1.1 MD13G1011800.v1.1 MD13G1012000.v1.1 MD13G1012100.v1.1 MD14G1061400.v1.1 MD14G1061900.v1.1 MD14G1062000.v1.1 MD14G1062100.v1.1 MD14G1073000.v1.1 MD16G1008800.v1.1 MD16G1008900.v1.1
prunus_persica	Prupe.1G341600_v2.0.a1 Prupe.1G341700_v2.0.a1 Prupe.7G070800_v2.0.a1 Prupe.7G070800_v2.0.a1 Prupe.7G070900_v2.0.a1 Prupe.7G071000_v2.0.a1 Prupe.7G071100_v2.0.a1 Prupe.7G071200_v2.0.a1 Prupe.7G071300_v2.0.a1 Prupe.7G071400_v2.0.a1 Prupe.7G073300_v2.0.a1
pyrus_communis	pycom11g08960 pycom11g08970 pycom12g12050 pycom13g00950 pycom13g00960 pycom13g00970 pycom13g00990 pycom16g00850
rosa_chinensis	RchiOBHm_Chr2g0115151
rosa_roxburghii	Rroxscaffold_2G00130630 Rroxscaffold_2G00139970 Rroxscaffold_6G00401520
rosa_rugosa	Rorug02G0111600 Rorug02G0194100 Rorug03G0183000
rosa_samantha	Rh2BG262100 Rh3BG267000
rosa_wichuraiana	Rw2G012500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	225
AciI	CCGC	5 cut(s)	16, 223, 225, 232, 235
AclWI	GGATC	1 cut(s)	12
AcsI	RAATTY	1 cut(s)	146
AfiI	CCNNNNNNNGG	1 cut(s)	52
AflIII	ACRYGT	1 cut(s)	125
AgsI	TTSAA	1 cut(s)	151
AluBI	AGCT	2 cut(s)	29, 177
AluI	AGCT	2 cut(s)	29, 177
Alw26I	GTCTC	1 cut(s)	28
AlwI	GGATC	1 cut(s)	12
AoxI	GGCC	1 cut(s)	214
ApeKI	GCWGC	2 cut(s)	29, 59
ApoI	RAATTY	1 cut(s)	146
AspS9I	GGNCC	1 cut(s)	71
AsuHPI	GGTGA	1 cut(s)	199
AvaII	GGWCC	1 cut(s)	71
BbsI	GAAGAC	1 cut(s)	128
BbvI	GCAGC	2 cut(s)	16, 46
BccI	CCATC	2 cut(s)	20, 61
BcoDI	GTCTC	1 cut(s)	28
BisI	GCNGC	4 cut(s)	30, 60, 223, 235
BlsI	GCNGC	4 cut(s)	31, 61, 224, 236
Bme18I	GGWCC	1 cut(s)	71
BmgT120I	GGNCC	1 cut(s)	71
BmiI	GGNNCC	1 cut(s)	72
BmsI	GCATC	1 cut(s)	230
BpiI	GAAGAC	1 cut(s)	128
BsaJI	CCNNGG	1 cut(s)	223
BsaWI	WCCGGW	1 cut(s)	209
Bsc4I	CCNNNNNNNGG	1 cut(s)	52
BseDI	CCNNGG	1 cut(s)	223
BseGI	GGATG	2 cut(s)	12, 162
BseLI	CCNNNNNNNGG	1 cut(s)	52
BseMII	CTCAG	2 cut(s)	39, 149
BseXI	GCAGC	2 cut(s)	16, 46
Bsh1236I	CGCG	1 cut(s)	225
BshFI	GGCC	1 cut(s)	216
BsiSI	CCGG	1 cut(s)	210
BslFI	GGGAC	2 cut(s)	84, 107
BslI	CCNNNNNNNGG	1 cut(s)	52
BsmAI	GTCTC	1 cut(s)	28
BsmFI	GGGAC	2 cut(s)	84, 107
BsnI	GGCC	1 cut(s)	216
Bsp143I	GATC	1 cut(s)	4
BspACI	CCGC	5 cut(s)	16, 223, 225, 232, 235
BspANI	GGCC	1 cut(s)	216
BspCNI	CTCAG	2 cut(s)	38, 148
BspFNI	CGCG	1 cut(s)	225
BspLI	GGNNCC	1 cut(s)	72
BspPI	GGATC	1 cut(s)	12
BssECI	CCNNGG	1 cut(s)	223
BssMI	GATC	1 cut(s)	4
BstDEI	CTNAG	3 cut(s)	25, 99, 135
BstDSI	CCRYGG	1 cut(s)	223
BstF5I	GGATG	2 cut(s)	12, 162
BstFNI	CGCG	1 cut(s)	225
BstKTI	GATC	1 cut(s)	7
BstMAI	GTCTC	1 cut(s)	28
BstMBI	GATC	1 cut(s)	4
BstMWI	GCNNNNNNNGC	4 cut(s)	15, 222, 231, 240
BstNSI	RCATGY	1 cut(s)	129
BstUI	CGCG	1 cut(s)	225
BstV1I	GCAGC	2 cut(s)	16, 46
BstV2I	GAAGAC	1 cut(s)	128
BsuRI	GGCC	1 cut(s)	216
BtgI	CCRYGG	1 cut(s)	223
BtsCI	GGATG	2 cut(s)	12, 162
Cfr13I	GGNCC	1 cut(s)	71
Cfr42I	CCGCGG	1 cut(s)	226
CseI	GACGC	1 cut(s)	104
CspCI	CAANNNNNGTGG	2 cut(s)	63, 98
CviAII	CATG	1 cut(s)	126
CviJI	RGCY	8 cut(s)	29, 59, 80, 112, 141, 177, 204, 216
CviKI_1	RGCY	8 cut(s)	29, 59, 80, 112, 141, 177, 204, 216
DdeI	CTNAG	3 cut(s)	25, 99, 135
DpnI	GATC	1 cut(s)	6
DpnII	GATC	1 cut(s)	4
EciI	GGCGGA	2 cut(s)	5, 221
Eco47I	GGWCC	1 cut(s)	71
FaeI	CATG	1 cut(s)	129
FaiI	YATR	1 cut(s)	127
FaqI	GGGAC	2 cut(s)	84, 107
FatI	CATG	1 cut(s)	125
Fnu4HI	GCNGC	4 cut(s)	30, 60, 223, 235
FokI	GGATG	1 cut(s)	169
Fsp4HI	GCNGC	4 cut(s)	30, 60, 223, 235
GluI	GCNGC	4 cut(s)	30, 60, 223, 235
HaeIII	GGCC	1 cut(s)	216
HapII	CCGG	1 cut(s)	210
HgaI	GACGC	1 cut(s)	104
Hin1II	CATG	1 cut(s)	129
HinfI	GANTC	1 cut(s)	131
HpaII	CCGG	1 cut(s)	210
HphI	GGTGA	1 cut(s)	199
Hpy188I	TCNGA	2 cut(s)	138, 199
HpyAV	CCTTC	3 cut(s)	43, 84, 97
HpyCH4V	TGCA	2 cut(s)	184, 192
HpyF10VI	GCNNNNNNNGC	4 cut(s)	15, 222, 231, 240
HpyF3I	CTNAG	3 cut(s)	25, 99, 135
Hsp92II	CATG	1 cut(s)	129
KspI	CCGCGG	1 cut(s)	226
Kzo9I	GATC	1 cut(s)	4
LmnI	GCTCC	2 cut(s)	14, 254
LpnPI	CCDG	2 cut(s)	59, 223
Lsp1109I	GCAGC	2 cut(s)	16, 46
LweI	GCATC	1 cut(s)	230
MalI	GATC	1 cut(s)	6
MboI	GATC	1 cut(s)	4
MboII	GAAGA	2 cut(s)	130, 133
MluCI	AATT	2 cut(s)	146, 256
MnlI	CCTC	3 cut(s)	79, 193, 206
MspA1I	CMGCKG	2 cut(s)	29, 225
MspI	CCGG	1 cut(s)	210
MvnI	CGCG	1 cut(s)	225
MwoI	GCNNNNNNNGC	4 cut(s)	15, 222, 231, 240
NdeII	GATC	1 cut(s)	4
NlaIII	CATG	1 cut(s)	129
NlaIV	GGNNCC	1 cut(s)	72
NmeAIII	GCCGAG	1 cut(s)	88
NspI	RCATGY	1 cut(s)	129
PciI	ACATGT	1 cut(s)	125
PfeI	GAWTC	1 cut(s)	131
PkrI	GCNGC	4 cut(s)	31, 61, 224, 236
PscI	ACATGT	1 cut(s)	125
PspN4I	GGNNCC	1 cut(s)	72
PspPI	GGNCC	1 cut(s)	71
PvuII	CAGCTG	1 cut(s)	29
SacII	CCGCGG	1 cut(s)	226
SatI	GCNGC	4 cut(s)	30, 60, 223, 235
Sau3AI	GATC	1 cut(s)	4
Sau96I	GGNCC	1 cut(s)	71
SetI	ASST	3 cut(s)	31, 108, 179
SfaNI	GCATC	1 cut(s)	230
Sfr303I	CCGCGG	1 cut(s)	226
SgrBI	CCGCGG	1 cut(s)	226
SinI	GGWCC	1 cut(s)	71
Sse9I	AATT	2 cut(s)	146, 256
SsiI	CCGC	5 cut(s)	16, 223, 225, 232, 235
TasI	AATT	2 cut(s)	146, 256
TauI	GCSGC	2 cut(s)	225, 237
TfiI	GAWTC	1 cut(s)	131
TseI	GCWGC	2 cut(s)	29, 59
VpaK11BI	GGWCC	1 cut(s)	71
XapI	RAATTY	1 cut(s)	146
XceI	RCATGY	1 cut(s)	129

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.