MD14G1061900.v1.1

Belongs to the DEFL family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0001299
Physical Location & Seq
Reverse (-)
6533806 .. 6534503
698 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1061900.v1.1.491

Sequence Viewer

Length: 273 bp
ATGGAACATTCTAGGCGTTTGTTTTCAACTGTCTTCATCCTCCTCCTCCTTCTGGTGACTATTGGAACGGGTCCAATGGTTGCTGAGGGGAAGACAAAAGAAAAGTCATCGAAGAATGAGAAGTCGTCGAAGATCTGTGAGTCTCCAAGCCATAAATTCCATGGAATTTGCTTCAGGTCAAGCAATTGTGCAACTACATGCAAAAAAGAGGGATTTATGGGAGGCAAATGTACTGGCTTTCGGATGAGATGTGTATGCACTAAAAAATGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Gamma-thionin

Protein Analysis

91

Amino Acids

9.98

Weight (kDa)

9.62

Isoelectric Point (pI)

39.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 44 - 90 3.4e-16 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 155, 165
AcuI CTGAAG 1 cut(s) 157
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 27
Alw26I GTCTC 1 cut(s) 147
ApoI RAATTY 2 cut(s) 155, 165
ArsI GACNNNNNNTTYG 2 cut(s) 89, 121
AspS9I GGNCC 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 67
AvaII GGWCC 1 cut(s) 71
BbsI GAAGAC 2 cut(s) 25, 98
BbvCI CCTCAGC 1 cut(s) 84
BcoDI GTCTC 1 cut(s) 147
BfaI CTAG 1 cut(s) 12
BglII AGATCT 1 cut(s) 132
Bme18I GGWCC 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 71
BmiI GGNNCC 1 cut(s) 72
BpiI GAAGAC 2 cut(s) 25, 98
Bpu10I CCTNAGC 1 cut(s) 84
BsaJI CCNNGG 1 cut(s) 160
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 238
BseDI CCNNGG 1 cut(s) 160
BseGI GGATG 2 cut(s) 36, 249
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 75
BseNI ACTGG 1 cut(s) 238
BseRI GAGGAG 2 cut(s) 32, 35
BslI CCNNNNNNNGG 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 147
Bsp143I GATC 1 cut(s) 132
Bsp19I CCATGG 1 cut(s) 160
BspCNI CTCAG 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 72
BsrI ACTGG 1 cut(s) 238
BssECI CCNNGG 1 cut(s) 160
BssMI GATC 1 cut(s) 132
BssT1I CCWWGG 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 84
BstDSI CCRYGG 1 cut(s) 160
BstF5I GGATG 2 cut(s) 36, 249
BstKTI GATC 1 cut(s) 135
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 1 cut(s) 132
BstNSI RCATGY 1 cut(s) 201
BstV2I GAAGAC 2 cut(s) 25, 98
BstX2I RGATCY 1 cut(s) 132
BstYI RGATCY 1 cut(s) 132
BtgI CCRYGG 1 cut(s) 160
BtsCI GGATG 2 cut(s) 36, 249
Cfr13I GGNCC 1 cut(s) 71
Csp6I GTAC 1 cut(s) 231
CviAII CATG 2 cut(s) 161, 198
CviJI RGCY 2 cut(s) 150, 237
CviKI_1 RGCY 2 cut(s) 150, 237
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 1 cut(s) 84
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 160
Eco47I GGWCC 1 cut(s) 71
Eco57I CTGAAG 1 cut(s) 157
EcoT14I CCWWGG 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 160
FaeI CATG 2 cut(s) 164, 201
FaiI YATR 5 cut(s) 153, 162, 199, 218, 256
FatI CATG 2 cut(s) 160, 197
FokI GGATG 2 cut(s) 23, 256
FspBI CTAG 1 cut(s) 12
Hin1II CATG 2 cut(s) 164, 201
HinfI GANTC 1 cut(s) 140
HphI GGTGA 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 243
Hpy99I CGWCG 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 3 cut(s) 191, 201, 258
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 2 cut(s) 164, 201
Kzo9I GATC 1 cut(s) 132
LpnPI CCDG 3 cut(s) 38, 160, 219
MaeI CTAG 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 55
MalI GATC 1 cut(s) 134
MboI GATC 1 cut(s) 132
MboII GAAGA 4 cut(s) 25, 103, 124, 142
MfeI CAATTG 1 cut(s) 184
MflI RGATCY 1 cut(s) 132
MluCI AATT 3 cut(s) 155, 165, 184
MlyI GAGTC 1 cut(s) 149
MnlI CCTC 6 cut(s) 50, 53, 56, 79, 202, 215
MseI TTAA 1 cut(s) 271
MunI CAATTG 1 cut(s) 184
NcoI CCATGG 1 cut(s) 160
NdeII GATC 1 cut(s) 132
NlaIII CATG 2 cut(s) 164, 201
NlaIV GGNNCC 1 cut(s) 72
NmuCI GTSAC 1 cut(s) 55
NspI RCATGY 1 cut(s) 201
PleI GAGTC 1 cut(s) 148
PpsI GAGTC 1 cut(s) 148
PspN4I GGNNCC 1 cut(s) 72
PspPI GGNCC 1 cut(s) 71
PsuI RGATCY 1 cut(s) 132
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
SaqAI TTAA 1 cut(s) 271
Sau3AI GATC 1 cut(s) 132
Sau96I GGNCC 1 cut(s) 71
SchI GAGTC 1 cut(s) 149
SetI ASST 1 cut(s) 179
SgeI CNNG 9 cut(s) 24, 65, 81, 159, 173, 187, 192, 210, 246
SinI GGWCC 1 cut(s) 71
Sse9I AATT 3 cut(s) 155, 165, 184
SspMI CTAG 1 cut(s) 12
StyI CCWWGG 1 cut(s) 160
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 2 cut(s) 110, 128
TasI AATT 3 cut(s) 155, 165, 184
TatI WGTACW 1 cut(s) 230
Tru1I TTAA 1 cut(s) 271
Tru9I TTAA 1 cut(s) 271
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 1 cut(s) 25
VpaK11BI GGWCC 1 cut(s) 71
XapI RAATTY 2 cut(s) 155, 165
XceI RCATGY 1 cut(s) 201
XcmI CCANNNNNNNNNTGG 1 cut(s) 158
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.