Rorug02G0111600

Belongs to the DEFL family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
9560635 .. 9560862
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0111600.1

Sequence Viewer

Length: 228 bp
ATGGAGGACTTCTCTGAGGTAGGGTGTATAGTTGAAGATTGCAAGGCATATTTAAGTGCTATTACTTCTTTTTCCTTACAACCTATTTTTCGTGAAGCAAATGGTGTGACCCATAGATTGGCACATCTTGTTAGTGTCTCTTACTTAGATGATTATTGGTTAGATGAGACTCCTGTGATTATCCTGATGTACTCTATGACGATTCTACTAATAGAACTCAAGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.56

Weight (kDa)

4.37

Isoelectric Point (pI)

31.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 118
AfaI GTAC 1 cut(s) 191
AfiI CCNNNNNNNGG 1 cut(s) 118
AgsI TTSAA 1 cut(s) 35
Alw26I GTCTC 2 cut(s) 142, 161
BcoDI GTCTC 2 cut(s) 142, 161
BplI GAGNNNNNCTC 1 cut(s) 28
BpuEI CTTGAG 1 cut(s) 203
Bsc4I CCNNNNNNNGG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 6
BslI CCNNNNNNNGG 1 cut(s) 118
BsmAI GTCTC 2 cut(s) 142, 161
BspCNI CTCAG 1 cut(s) 7
BstDEI CTNAG 2 cut(s) 15, 145
BstMAI GTCTC 2 cut(s) 142, 161
Csp6I GTAC 1 cut(s) 190
CviQI GTAC 1 cut(s) 190
DdeI CTNAG 2 cut(s) 15, 145
FaiI YATR 4 cut(s) 29, 49, 114, 197
HinfI GANTC 2 cut(s) 169, 202
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 92, 184
HpyCH4V TGCA 1 cut(s) 42
HpyF3I CTNAG 2 cut(s) 15, 145
LpnPI CCDG 2 cut(s) 186, 197
MaeIII GTNAC 1 cut(s) 106
MboII GAAGA 1 cut(s) 47
MlyI GAGTC 1 cut(s) 163
MnlI CCTC 1 cut(s) 10
MseI TTAA 1 cut(s) 53
NmuCI GTSAC 1 cut(s) 106
PfeI GAWTC 1 cut(s) 202
PflMI CCANNNNNTGG 1 cut(s) 118
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
RsaI GTAC 1 cut(s) 191
RsaNI GTAC 1 cut(s) 190
SaqAI TTAA 1 cut(s) 53
SchI GAGTC 1 cut(s) 163
SetI ASST 3 cut(s) 21, 85, 225
SgeI CNNG 5 cut(s) 55, 104, 140, 185, 196
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
TatI WGTACW 1 cut(s) 189
TfiI GAWTC 1 cut(s) 202
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
Van91I CCANNNNNTGG 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.