Prupe.7G071200_v2.0.a1

Belongs to the DEFL family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
10879360 .. 10880134
775 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G071200.1

Sequence Viewer

Length: 258 bp
ATGGAGGGATCCAAACGTATGTTTTCAACTGTCTTCATCCTCGTCCTGCTCTTTGTGGCTATTGGGACGGGTCCAATGGTTGCTGAGGGCAAGGTCGAAACAAAGGAGACGTCCAGGACTTGTGAGTCTTTGAGCACGAAATTCAAGGGACCTTGCATCCGATCAAGCAACTGTGCAAATATTTGCGAAGAAGAAGGCTTCAAGGGAGGCAAATGTGTTGGCTTCAGGCTGAGATGTACGTGCACTAAGAATTGTTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.25

Weight (kDa)

8.88

Isoelectric Point (pI)

37.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 124
AatII GACGTC 1 cut(s) 113
AclWI GGATC 2 cut(s) 3, 16
AcsI RAATTY 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 208
AcyI GRCGYC 1 cut(s) 110
AfaI GTAC 1 cut(s) 238
AgsI TTSAA 3 cut(s) 27, 145, 202
AjnI CCWGG 1 cut(s) 113
Alw21I GWGCWC 2 cut(s) 137, 245
Alw26I GTCTC 1 cut(s) 101
Alw44I GTGCAC 1 cut(s) 241
AlwI GGATC 2 cut(s) 3, 16
ApaLI GTGCAC 1 cut(s) 241
ApoI RAATTY 1 cut(s) 140
ArsI GACNNNNNNTTYG 2 cut(s) 95, 127
AspS9I GGNCC 2 cut(s) 71, 149
AvaII GGWCC 2 cut(s) 71, 149
BaeGI GKGCMC 1 cut(s) 245
BamHI GGATCC 1 cut(s) 8
BbsI GAAGAC 1 cut(s) 25
Bbv12I GWGCWC 2 cut(s) 137, 245
BbvCI CCTCAGC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 115
BcoDI GTCTC 1 cut(s) 101
Bme1390I CCNGG 1 cut(s) 115
Bme18I GGWCC 2 cut(s) 71, 149
BmgT120I GGNCC 2 cut(s) 71, 149
BmiI GGNNCC 3 cut(s) 10, 72, 150
BmrFI CCNGG 1 cut(s) 115
BmsI GCATC 1 cut(s) 165
BpiI GAAGAC 1 cut(s) 25
Bpu10I CCTNAGC 1 cut(s) 84
BsaAI YACGTR 1 cut(s) 240
BsaHI GRCGYC 1 cut(s) 110
BseBI CCWGG 1 cut(s) 115
BseGI GGATG 2 cut(s) 36, 156
BseMII CTCAG 2 cut(s) 75, 221
BseSI GKGCMC 1 cut(s) 245
BsiHKAI GWGCWC 2 cut(s) 137, 245
BslFI GGGAC 2 cut(s) 79, 162
BsmAI GTCTC 1 cut(s) 101
BsmBI CGTCTC 1 cut(s) 101
BsmFI GGGAC 2 cut(s) 79, 162
Bsp1286I GDGCHC 2 cut(s) 137, 245
Bsp143I GATC 2 cut(s) 8, 161
BspCNI CTCAG 2 cut(s) 76, 222
BspLI GGNNCC 3 cut(s) 10, 72, 150
BspPI GGATC 2 cut(s) 3, 16
BssMI GATC 2 cut(s) 8, 161
BssNI GRCGYC 1 cut(s) 110
Bst2UI CCWGG 1 cut(s) 115
Bst4CI ACNGT 2 cut(s) 31, 173
BstACI GRCGYC 1 cut(s) 110
BstBAI YACGTR 1 cut(s) 240
BstDEI CTNAG 3 cut(s) 84, 230, 246
BstF5I GGATG 2 cut(s) 36, 156
BstKTI GATC 2 cut(s) 11, 164
BstMAI GTCTC 1 cut(s) 101
BstMBI GATC 2 cut(s) 8, 161
BstNI CCWGG 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 113
BstSLI GKGCMC 1 cut(s) 245
BstV2I GAAGAC 1 cut(s) 25
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
BtsCI GGATG 2 cut(s) 36, 156
Cfr13I GGNCC 2 cut(s) 71, 149
Csp6I GTAC 1 cut(s) 237
CviJI RGCY 4 cut(s) 59, 198, 222, 229
CviKI_1 RGCY 4 cut(s) 59, 198, 222, 229
CviQI GTAC 1 cut(s) 237
DdeI CTNAG 3 cut(s) 84, 230, 246
DpnI GATC 2 cut(s) 10, 163
DpnII GATC 2 cut(s) 8, 161
DrdI GACNNNNNNGTC 1 cut(s) 124
DseDI GACNNNNNNGTC 1 cut(s) 124
Eco47I GGWCC 2 cut(s) 71, 149
Eco57I CTGAAG 1 cut(s) 208
EcoO109I RGGNCCY 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 113
Esp3I CGTCTC 1 cut(s) 101
FaiI YATR 1 cut(s) 20
FaqI GGGAC 2 cut(s) 79, 162
FokI GGATG 2 cut(s) 23, 143
Hin1I GRCGYC 1 cut(s) 110
HinfI GANTC 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 243
Hpy188I TCNGA 1 cut(s) 161
Hpy8I GTNNAC 1 cut(s) 243
HpyAV CCTTC 1 cut(s) 188
HpyCH4III ACNGT 2 cut(s) 31, 173
HpyCH4IV ACGT 3 cut(s) 16, 110, 239
HpyCH4V TGCA 3 cut(s) 156, 176, 243
HpyF3I CTNAG 3 cut(s) 84, 230, 246
HpySE526I ACGT 3 cut(s) 16, 110, 239
Hsp92I GRCGYC 1 cut(s) 110
Kzo9I GATC 2 cut(s) 8, 161
LpnPI CCDG 4 cut(s) 59, 100, 127, 211
LweI GCATC 1 cut(s) 165
MaeII ACGT 3 cut(s) 16, 110, 239
MalI GATC 2 cut(s) 10, 163
MboI GATC 2 cut(s) 8, 161
MboII GAAGA 3 cut(s) 25, 200, 203
MflI RGATCY 1 cut(s) 8
MhlI GDGCHC 2 cut(s) 137, 245
MluCI AATT 2 cut(s) 140, 250
MlyI GAGTC 1 cut(s) 134
MnlI CCTC 3 cut(s) 50, 79, 200
MspR9I CCNGG 1 cut(s) 115
MvaI CCWGG 1 cut(s) 115
NdeII GATC 2 cut(s) 8, 161
NlaIV GGNNCC 3 cut(s) 10, 72, 150
PfoI TCCNGGA 1 cut(s) 113
PleI GAGTC 1 cut(s) 133
PpsI GAGTC 1 cut(s) 133
Ppu21I YACGTR 1 cut(s) 240
PpuMI RGGWCCY 1 cut(s) 149
Psp5II RGGWCCY 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 113
PspGI CCWGG 1 cut(s) 113
PspN4I GGNNCC 3 cut(s) 10, 72, 150
PspPI GGNCC 2 cut(s) 71, 149
PspPPI RGGWCCY 1 cut(s) 149
PsuI RGATCY 1 cut(s) 8
RsaI GTAC 1 cut(s) 238
RsaNI GTAC 1 cut(s) 237
Sau3AI GATC 2 cut(s) 8, 161
Sau96I GGNCC 2 cut(s) 71, 149
SchI GAGTC 1 cut(s) 134
ScrFI CCNGG 1 cut(s) 115
SduI GDGCHC 2 cut(s) 137, 245
SetI ASST 5 cut(s) 19, 96, 113, 154, 242
SfaNI GCATC 1 cut(s) 165
SinI GGWCC 2 cut(s) 71, 149
Sse9I AATT 2 cut(s) 140, 250
SspI AATATT 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 113
TaaI ACNGT 2 cut(s) 31, 173
TaiI ACGT 3 cut(s) 19, 113, 242
TaqI TCGA 1 cut(s) 96
TasI AATT 2 cut(s) 140, 250
TspDTI ATGAA 1 cut(s) 25
VneI GTGCAC 1 cut(s) 241
VpaK11BI GGWCC 2 cut(s) 71, 149
XapI RAATTY 1 cut(s) 140
ZraI GACGTC 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.