FvH4_1g21223

RRP12-like protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
13249459 .. 13250042
584 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g21223.t1

Sequence Viewer

Length: 327 bp
ATGGACGCTGCATTTGAAATTGTTTCGACAATGAAACAGGCCACTCTTCTTCTTGGATCACTTGTCGAGGAGAAATGTGGACTAAATGATGTTAATATTATAGCTCTCCTGCCTCAAGGACAACTCATGGAACTGCTTGCAGATTACACGGGACTTAAATCCATAGAAAAGCTGGAATTTTCTCATCGAAAACGGAAGGAGGATTTTGATCTTGGGTCCCTCCCAGGAGGGCTTCCATATGGTCGACGTTCAGCAGAGTTTAAGGCCGAGGCAGCTGCAGCTGCCATATATGGTGCTGCGCAGATAGCAAAGAAGATGAAACTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

11.73

Weight (kDa)

6.58

Isoelectric Point (pI)

41.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 300
AccI GTMKAC 1 cut(s) 244
AclWI GGATC 1 cut(s) 64
AcsI RAATTY 1 cut(s) 176
AgsI TTSAA 1 cut(s) 17
AjnI CCWGG 1 cut(s) 223
AluBI AGCT 4 cut(s) 104, 172, 275, 281
AluI AGCT 4 cut(s) 104, 172, 275, 281
AlwI GGATC 1 cut(s) 64
AoxI GGCC 2 cut(s) 39, 264
ApeKI GCWGC 6 cut(s) 8, 272, 275, 278, 281, 296
ApoI RAATTY 1 cut(s) 176
ArsI GACNNNNNNTTYG 1 cut(s) 28
AspLEI GCGC 1 cut(s) 301
AspS9I GGNCC 1 cut(s) 216
AvaII GGWCC 1 cut(s) 216
BbvI GCAGC 5 cut(s) 262, 268, 283, 284, 290
BcgI CGANNNNNNTGC 2 cut(s) 257, 291
BciT130I CCWGG 1 cut(s) 225
BfmI CTRYAG 1 cut(s) 276
BisI GCNGC 6 cut(s) 9, 273, 276, 279, 282, 297
BlsI GCNGC 6 cut(s) 10, 274, 277, 280, 283, 298
Bme1390I CCNGG 1 cut(s) 225
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BmiI GGNNCC 2 cut(s) 217, 218
BmrFI CCNGG 1 cut(s) 225
BpuEI CTTGAG 1 cut(s) 99
BsaBI GATNNNNATC 1 cut(s) 207
BsaJI CCNNGG 2 cut(s) 223, 267
Bse8I GATNNNNATC 1 cut(s) 207
BseBI CCWGG 1 cut(s) 225
BseDI CCNNGG 2 cut(s) 223, 267
BseJI GATNNNNATC 1 cut(s) 207
BseRI GAGGAG 1 cut(s) 83
BseXI GCAGC 5 cut(s) 262, 268, 283, 284, 290
BshFI GGCC 2 cut(s) 41, 266
BslFI GGGAC 2 cut(s) 165, 202
BsmFI GGGAC 2 cut(s) 165, 202
BsnI GGCC 2 cut(s) 41, 266
Bsp143I GATC 2 cut(s) 56, 208
BspANI GGCC 2 cut(s) 41, 266
BspLI GGNNCC 2 cut(s) 217, 218
BspMAI CTGCAG 1 cut(s) 280
BspPI GGATC 1 cut(s) 64
BssECI CCNNGG 2 cut(s) 223, 267
BssMI GATC 2 cut(s) 56, 208
Bst2UI CCWGG 1 cut(s) 225
Bst6I CTCTTC 1 cut(s) 51
BstC8I GCNNGC 1 cut(s) 138
BstHHI GCGC 1 cut(s) 301
BstKTI GATC 2 cut(s) 59, 211
BstMBI GATC 2 cut(s) 56, 208
BstMWI GCNNNNNNNGC 4 cut(s) 272, 278, 281, 305
BstNI CCWGG 1 cut(s) 225
BstSCI CCNGG 1 cut(s) 223
BstSFI CTRYAG 1 cut(s) 276
BstV1I GCAGC 5 cut(s) 262, 268, 283, 284, 290
BsuRI GGCC 2 cut(s) 41, 266
Cac8I GCNNGC 1 cut(s) 138
CfoI GCGC 1 cut(s) 301
Cfr13I GGNCC 1 cut(s) 216
CseI GACGC 1 cut(s) 14
CviAII CATG 1 cut(s) 127
CviJI RGCY 7 cut(s) 41, 104, 172, 232, 266, 275, 281
CviKI_1 RGCY 7 cut(s) 41, 104, 172, 232, 266, 275, 281
DpnI GATC 2 cut(s) 58, 210
DpnII GATC 2 cut(s) 56, 208
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 216
EcoO109I RGGNCCY 1 cut(s) 216
EcoRII CCWGG 1 cut(s) 223
FaeI CATG 1 cut(s) 130
FaiI YATR 8 cut(s) 101, 128, 164, 238, 240, 287, 289, 291
FaqI GGGAC 2 cut(s) 165, 202
FatI CATG 1 cut(s) 126
FauNDI CATATG 1 cut(s) 238
FblI GTMKAC 1 cut(s) 244
Fnu4HI GCNGC 6 cut(s) 9, 273, 276, 279, 282, 297
Fsp4HI GCNGC 6 cut(s) 9, 273, 276, 279, 282, 297
FspI TGCGCA 1 cut(s) 300
GlaI GCGC 1 cut(s) 300
GluI GCNGC 6 cut(s) 9, 273, 276, 279, 282, 297
HaeIII GGCC 2 cut(s) 41, 266
HgaI GACGC 1 cut(s) 14
HhaI GCGC 1 cut(s) 301
Hin1II CATG 1 cut(s) 130
Hin6I GCGC 1 cut(s) 299
HinP1I GCGC 1 cut(s) 299
HincII GTYRAC 1 cut(s) 245
HindII GTYRAC 1 cut(s) 245
Hpy166II GTNNAC 2 cut(s) 80, 245
Hpy8I GTNNAC 2 cut(s) 80, 245
Hpy99I CGWCG 1 cut(s) 249
HpyAV CCTTC 1 cut(s) 190
HpyCH4IV ACGT 1 cut(s) 247
HpyCH4V TGCA 3 cut(s) 11, 140, 278
HpyF10VI GCNNNNNNNGC 4 cut(s) 272, 278, 281, 305
HpySE526I ACGT 1 cut(s) 247
Hsp92II CATG 1 cut(s) 130
HspAI GCGC 1 cut(s) 299
KflI GGGWCCC 1 cut(s) 216
Kzo9I GATC 2 cut(s) 56, 208
LpnPI CCDG 5 cut(s) 23, 122, 158, 210, 237
Lsp1109I GCAGC 5 cut(s) 262, 268, 283, 284, 290
MaeII ACGT 1 cut(s) 247
MalI GATC 2 cut(s) 58, 210
MboI GATC 2 cut(s) 56, 208
MboII GAAGA 3 cut(s) 38, 41, 325
MluCI AATT 2 cut(s) 18, 176
MnlI CCTC 6 cut(s) 61, 123, 193, 221, 230, 262
MseI TTAA 4 cut(s) 93, 156, 261, 325
MspA1I CMGCKG 2 cut(s) 275, 281
MspR9I CCNGG 1 cut(s) 225
MvaI CCWGG 1 cut(s) 225
MwoI GCNNNNNNNGC 4 cut(s) 272, 278, 281, 305
NdeI CATATG 1 cut(s) 238
NdeII GATC 2 cut(s) 56, 208
NlaIII CATG 1 cut(s) 130
NlaIV GGNNCC 2 cut(s) 217, 218
NmeAIII GCCGAG 1 cut(s) 292
NsbI TGCGCA 1 cut(s) 300
PkrI GCNGC 6 cut(s) 10, 274, 277, 280, 283, 298
PpuMI RGGWCCY 1 cut(s) 216
Psp5II RGGWCCY 1 cut(s) 216
Psp6I CCWGG 1 cut(s) 223
PspGI CCWGG 1 cut(s) 223
PspN4I GGNNCC 2 cut(s) 217, 218
PspPI GGNCC 1 cut(s) 216
PspPPI RGGWCCY 1 cut(s) 216
PstI CTGCAG 1 cut(s) 280
PvuII CAGCTG 2 cut(s) 275, 281
SalI GTCGAC 1 cut(s) 243
SaqAI TTAA 4 cut(s) 93, 156, 261, 325
SatI GCNGC 6 cut(s) 9, 273, 276, 279, 282, 297
Sau3AI GATC 2 cut(s) 56, 208
Sau96I GGNCC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 225
SetI ASST 5 cut(s) 106, 174, 250, 277, 283
SfcI CTRYAG 1 cut(s) 276
SinI GGWCC 1 cut(s) 216
SmlI CTYRAG 1 cut(s) 114
SmoI CTYRAG 1 cut(s) 114
Sse9I AATT 2 cut(s) 18, 176
SspI AATATT 1 cut(s) 97
StyD4I CCNGG 1 cut(s) 223
TaiI ACGT 1 cut(s) 250
TaqI TCGA 4 cut(s) 26, 66, 187, 244
TasI AATT 2 cut(s) 18, 176
Tru1I TTAA 4 cut(s) 93, 156, 261, 325
Tru9I TTAA 4 cut(s) 93, 156, 261, 325
TseI GCWGC 6 cut(s) 8, 272, 275, 278, 281, 296
TspDTI ATGAA 1 cut(s) 47
TspGWI ACGGA 1 cut(s) 208
VpaK11BI GGWCC 1 cut(s) 216
XapI RAATTY 1 cut(s) 176
XcmI CCANNNNNNNNNTGG 1 cut(s) 169
XmiI GTMKAC 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.