Rh2BG261100

RRP12-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0000835
Physical Location & Seq
Reverse (-)
27888580 .. 27889298
719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG261100.1

Sequence Viewer

Length: 441 bp
ATGGAACTTGCATTTGAAGTTGTTTCAACAATGTTCGATAAATTAGGGGCATACGCTTCTTACTTCATGAGGGGCACGCTGGAGAACTTGGCAGCCATGCACAAGTTGCCTGATGAAGACTTCCCGTTTAGGAAGCAGGCCACTCTTCTTCTAGGATCGCTTGTCGAGGAGAAATGTGGGCTAAATGATGTTAATATTACTGCTGTCCTGCCTCAAGGACAACTCAGAGAACTGCTTGCAGATTCTAGGGGACTTAAAGGCATATCAAGGTCGGAACTTTCTCATCGAAAATGGAAGATGGGGTTAAATATTGAGCCCTTTCTAGGAAGGGACTGGTCAGAGGAGATGAGGGCTGAGGAAGCTACAATTACAGCCATATCTGGTGCAGCGCAAATGACAAAGATTCAAAGAAGATTAAACTCGATAACCAGGCTTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NUC173

Protein Analysis

146

Amino Acids

16.43

Weight (kDa)

6.75

Isoelectric Point (pI)

54.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 163
AfiI CCNNNNNNNGG 1 cut(s) 323
AgsI TTSAA 3 cut(s) 17, 27, 407
AjnI CCWGG 1 cut(s) 428
AluBI AGCT 1 cut(s) 362
AluI AGCT 1 cut(s) 362
AlwI GGATC 1 cut(s) 163
AoxI GGCC 1 cut(s) 138
ApeKI GCWGC 2 cut(s) 92, 386
AspLEI GCGC 1 cut(s) 391
BaeGI GKGCMC 1 cut(s) 77
BanII GRGCYC 1 cut(s) 318
BbsI GAAGAC 1 cut(s) 123
BbvCI CCTCAGC 1 cut(s) 354
BbvI GCAGC 2 cut(s) 104, 398
BccI CCATC 1 cut(s) 292
BciT130I CCWGG 1 cut(s) 430
BfaI CTAG 3 cut(s) 152, 246, 323
BisI GCNGC 2 cut(s) 93, 387
BlsI GCNGC 2 cut(s) 94, 388
Bme1390I CCNGG 1 cut(s) 430
BmrFI CCNGG 1 cut(s) 430
BpiI GAAGAC 1 cut(s) 123
BpmI CTGGAG 1 cut(s) 101
Bpu10I CCTNAGC 1 cut(s) 354
BpuEI CTTGAG 1 cut(s) 198
Bsc4I CCNNNNNNNGG 1 cut(s) 323
Bse1I ACTGG 1 cut(s) 338
BseBI CCWGG 1 cut(s) 430
BseLI CCNNNNNNNGG 1 cut(s) 323
BseMII CTCAG 2 cut(s) 238, 345
BseNI ACTGG 1 cut(s) 338
BseRI GAGGAG 2 cut(s) 182, 356
BseSI GKGCMC 1 cut(s) 77
BseXI GCAGC 2 cut(s) 104, 398
BsgI GTGCAG 1 cut(s) 405
BshFI GGCC 1 cut(s) 140
BslFI GGGAC 2 cut(s) 264, 344
BslI CCNNNNNNNGG 1 cut(s) 323
BsmFI GGGAC 2 cut(s) 264, 344
BsnI GGCC 1 cut(s) 140
Bsp1286I GDGCHC 2 cut(s) 77, 318
Bsp143I GATC 1 cut(s) 155
BspANI GGCC 1 cut(s) 140
BspCNI CTCAG 2 cut(s) 237, 346
BspHI TCATGA 1 cut(s) 66
BspPI GGATC 1 cut(s) 163
BsrI ACTGG 1 cut(s) 338
BssMI GATC 1 cut(s) 155
Bst2UI CCWGG 1 cut(s) 430
Bst6I CTCTTC 1 cut(s) 150
BstAPI GCANNNNNTGC 1 cut(s) 106
BstC8I GCNNGC 3 cut(s) 77, 138, 237
BstDEI CTNAG 2 cut(s) 224, 354
BstHHI GCGC 1 cut(s) 391
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BstMWI GCNNNNNNNGC 2 cut(s) 106, 359
BstNI CCWGG 1 cut(s) 430
BstSCI CCNGG 1 cut(s) 428
BstSLI GKGCMC 1 cut(s) 77
BstV1I GCAGC 2 cut(s) 104, 398
BstV2I GAAGAC 1 cut(s) 123
BsuRI GGCC 1 cut(s) 140
Cac8I GCNNGC 3 cut(s) 77, 138, 237
CciI TCATGA 1 cut(s) 66
CfoI GCGC 1 cut(s) 391
CviAII CATG 2 cut(s) 67, 97
CviJI RGCY 8 cut(s) 95, 140, 181, 316, 353, 362, 374, 433
CviKI_1 RGCY 8 cut(s) 95, 140, 181, 316, 353, 362, 374, 433
DdeI CTNAG 2 cut(s) 224, 354
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco24I GRGCYC 1 cut(s) 318
EcoRII CCWGG 1 cut(s) 428
EcoT38I GRGCYC 1 cut(s) 318
FaeI CATG 2 cut(s) 70, 100
FaiI YATR 5 cut(s) 52, 68, 98, 263, 377
FaqI GGGAC 2 cut(s) 264, 344
FatI CATG 2 cut(s) 66, 96
Fnu4HI GCNGC 2 cut(s) 93, 387
FriOI GRGCYC 1 cut(s) 318
Fsp4HI GCNGC 2 cut(s) 93, 387
FspBI CTAG 3 cut(s) 152, 246, 323
GlaI GCGC 1 cut(s) 390
GluI GCNGC 2 cut(s) 93, 387
GsuI CTGGAG 1 cut(s) 101
HaeIII GGCC 1 cut(s) 140
HhaI GCGC 1 cut(s) 391
Hin1II CATG 2 cut(s) 70, 100
Hin6I GCGC 1 cut(s) 389
HinP1I GCGC 1 cut(s) 389
HinfI GANTC 2 cut(s) 242, 403
Hpy188I TCNGA 3 cut(s) 227, 274, 340
Hpy188III TCNNGA 1 cut(s) 67
HpyAV CCTTC 1 cut(s) 321
HpyCH4V TGCA 4 cut(s) 11, 100, 239, 386
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 359
HpyF3I CTNAG 2 cut(s) 224, 354
Hsp92II CATG 2 cut(s) 70, 100
HspAI GCGC 1 cut(s) 389
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 7 cut(s) 65, 122, 123, 221, 319, 366, 415
Lsp1109I GCAGC 2 cut(s) 104, 398
MaeI CTAG 3 cut(s) 152, 246, 323
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 5 cut(s) 128, 137, 140, 307, 423
MhlI GDGCHC 2 cut(s) 77, 318
MluCI AATT 2 cut(s) 41, 366
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 6 cut(s) 63, 160, 222, 334, 342, 349
MseI TTAA 5 cut(s) 192, 255, 305, 416, 439
MspR9I CCNGG 1 cut(s) 430
MvaI CCWGG 1 cut(s) 430
MwoI GCNNNNNNNGC 2 cut(s) 106, 359
NdeII GATC 1 cut(s) 155
NlaIII CATG 2 cut(s) 70, 100
PagI TCATGA 1 cut(s) 66
PfeI GAWTC 2 cut(s) 242, 403
PkrI GCNGC 2 cut(s) 94, 388
Psp6I CCWGG 1 cut(s) 428
PspGI CCWGG 1 cut(s) 428
SaqAI TTAA 5 cut(s) 192, 255, 305, 416, 439
SatI GCNGC 2 cut(s) 93, 387
Sau3AI GATC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 430
SduI GDGCHC 2 cut(s) 77, 318
SetI ASST 2 cut(s) 272, 364
SmlI CTYRAG 1 cut(s) 213
SmoI CTYRAG 1 cut(s) 213
Sse9I AATT 2 cut(s) 41, 366
SspI AATATT 2 cut(s) 196, 310
SspMI CTAG 3 cut(s) 152, 246, 323
StyD4I CCNGG 1 cut(s) 428
TaqI TCGA 4 cut(s) 36, 165, 286, 422
TasI AATT 2 cut(s) 41, 366
TfiI GAWTC 2 cut(s) 242, 403
Tru1I TTAA 5 cut(s) 192, 255, 305, 416, 439
Tru9I TTAA 5 cut(s) 192, 255, 305, 416, 439
TseI GCWGC 2 cut(s) 92, 386
TspDTI ATGAA 2 cut(s) 55, 129
XspI CTAG 3 cut(s) 152, 246, 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.