Rmu_co8218578.1_g000001

RRP12-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8218578.1
Physical Location & Seq
Reverse (-)
68 .. 737
670 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8218578.1_g000001.1.cds

Sequence Viewer

Length: 670 bp
acctgtacaagaggatgacggtaatatagaagaggacattgacgcagcagcaaacgcattcaagtgtgtcattcatgcttgtgttgatcaaggcttgatcaaacagggagttgacaagatcggtgccattgcaaacaagtatgagcctcagcctcaggagtcgaccataatagaaaaattgtgtgctactattcactgcagcttgcttggttatcaccagactaatgctcctgctctcagcatggaccttgcatttgaagttgtttcgacaatgttcaataaattaggggcatatgcttcttatttcatgagaggtacactggagaggttggcagacatgcacaagttgcttgatgaagaattccctttcaggaagcaggctacacttcttctagaatcccttgtcgaggagaaatgtgggcttcatgatgatatcaatattagggttgtcctgcctcaagaacaactcatggcactgcttgcagattacagaggccttaagtcccaaaaaaagtcagaactttctcatcgaaaacggaagatggggttgaatattgggtccccccccccaggaaggttgccgtacgattgttcaccagagatgatggctgaggcagctaaagctgcggtatctggtgctgcgcagatagcaaagaagattaaactctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

222

Amino Acids

24.47

Weight (kDa)

5.91

Isoelectric Point (pI)

54.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 643
AccB1I GGYRCC 1 cut(s) 123
AccI GTMKAC 1 cut(s) 162
AciI CCGC 1 cut(s) 627
AcsI RAATTY 1 cut(s) 360
AfaI GTAC 3 cut(s) 7, 317, 585
AfiI CCNNNNNNNGG 3 cut(s) 407, 570, 574
AflII CTTAAG 1 cut(s) 498
AgsI TTSAA 4 cut(s) 62, 258, 278, 551
AjnI CCWGG 1 cut(s) 569
AluBI AGCT 3 cut(s) 202, 618, 624
AluI AGCT 3 cut(s) 202, 618, 624
AoxI GGCC 1 cut(s) 494
ApeKI GCWGC 6 cut(s) 45, 48, 199, 615, 624, 639
ApoI RAATTY 1 cut(s) 360
ArsI GACNNNNNNTTYG 2 cut(s) 237, 269
AspLEI GCGC 1 cut(s) 644
AspS9I GGNCC 2 cut(s) 245, 559
AsuHPI GGTGA 2 cut(s) 207, 586
AvaII GGWCC 2 cut(s) 245, 559
AxyI CCTNAGG 1 cut(s) 154
BanI GGYRCC 1 cut(s) 123
BbvCI CCTCAGC 2 cut(s) 148, 610
BbvI GCAGC 6 cut(s) 57, 60, 211, 611, 626, 627
BccI CCATC 2 cut(s) 536, 599
BceAI ACGGC 1 cut(s) 566
BciT130I CCWGG 1 cut(s) 571
BclI TGATCA 2 cut(s) 86, 97
BfaI CTAG 1 cut(s) 393
BfmI CTRYAG 1 cut(s) 197
BfrI CTTAAG 1 cut(s) 498
BisI GCNGC 6 cut(s) 46, 49, 200, 616, 625, 640
BlsI GCNGC 6 cut(s) 47, 50, 201, 617, 626, 641
Bme1390I CCNGG 1 cut(s) 571
Bme18I GGWCC 2 cut(s) 245, 559
BmgT120I GGNCC 2 cut(s) 245, 559
BmiI GGNNCC 3 cut(s) 125, 560, 561
BmrFI CCNGG 1 cut(s) 571
BpmI CTGGAG 1 cut(s) 342
Bpu10I CCTNAGC 2 cut(s) 148, 610
BpuEI CTTGAG 1 cut(s) 442
BsaJI CCNNGG 1 cut(s) 569
BsaXI ACNNNNNCTCC 2 cut(s) 212, 242
Bsc4I CCNNNNNNNGG 3 cut(s) 407, 570, 574
Bse1I ACTGG 1 cut(s) 325
Bse21I CCTNAGG 1 cut(s) 154
Bse3DI GCAATG 1 cut(s) 127
BseBI CCWGG 1 cut(s) 571
BseDI CCNNGG 1 cut(s) 569
BseGI GGATG 1 cut(s) 20
BseLI CCNNNNNNNGG 3 cut(s) 407, 570, 574
BseMI GCAATG 1 cut(s) 127
BseMII CTCAG 4 cut(s) 162, 168, 251, 601
BseNI ACTGG 1 cut(s) 325
BseRI GAGGAG 1 cut(s) 423
BseXI GCAGC 6 cut(s) 57, 60, 211, 611, 626, 627
BshFI GGCC 1 cut(s) 496
BshNI GGYRCC 1 cut(s) 123
BsiWI CGTACG 1 cut(s) 583
BslFI GGGAC 2 cut(s) 488, 545
BslI CCNNNNNNNGG 3 cut(s) 407, 570, 574
BsmFI GGGAC 2 cut(s) 488, 545
BsmI GAATGC 1 cut(s) 57
BsnI GGCC 1 cut(s) 496
Bsp1407I TGTACA 1 cut(s) 5
Bsp143I GATC 3 cut(s) 86, 97, 118
BspACI CCGC 1 cut(s) 627
BspANI GGCC 1 cut(s) 496
BspCNI CTCAG 4 cut(s) 161, 167, 250, 602
BspHI TCATGA 2 cut(s) 307, 425
BspLI GGNNCC 3 cut(s) 125, 560, 561
BspMAI CTGCAG 1 cut(s) 201
BspT107I GGYRCC 1 cut(s) 123
BspTI CTTAAG 1 cut(s) 498
BsrDI GCAATG 1 cut(s) 127
BsrGI TGTACA 1 cut(s) 5
BsrI ACTGG 1 cut(s) 325
BssECI CCNNGG 1 cut(s) 569
BssMI GATC 3 cut(s) 86, 97, 118
Bst2UI CCWGG 1 cut(s) 571
Bst4CI ACNGT 1 cut(s) 21
Bst6I CTCTTC 1 cut(s) 25
BstAFI CTTAAG 1 cut(s) 498
BstAPI GCANNNNNTGC 2 cut(s) 347, 480
BstAUI TGTACA 1 cut(s) 5
BstC8I GCNNGC 3 cut(s) 204, 379, 481
BstDEI CTNAG 4 cut(s) 148, 154, 237, 610
BstENI CCTNNNNNAGG 1 cut(s) 405
BstF5I GGATG 1 cut(s) 20
BstHHI GCGC 1 cut(s) 644
BstKTI GATC 3 cut(s) 89, 100, 121
BstMBI GATC 3 cut(s) 86, 97, 118
BstMWI GCNNNNNNNGC 7 cut(s) 54, 347, 480, 615, 621, 624, 648
BstNI CCWGG 1 cut(s) 571
BstNSI RCATGY 1 cut(s) 341
BstSCI CCNGG 1 cut(s) 569
BstSFI CTRYAG 1 cut(s) 197
BstV1I GCAGC 6 cut(s) 57, 60, 211, 611, 626, 627
Bsu36I CCTNAGG 1 cut(s) 154
BsuRI GGCC 1 cut(s) 496
BtsCI GGATG 1 cut(s) 20
BtsI GCAGTG 2 cut(s) 194, 474
BtsIMutI CAGTG 3 cut(s) 194, 318, 474
Cac8I GCNNGC 3 cut(s) 204, 379, 481
CciI TCATGA 2 cut(s) 307, 425
CfoI GCGC 1 cut(s) 644
Cfr13I GGNCC 2 cut(s) 245, 559
CseI GACGC 1 cut(s) 51
Csp6I GTAC 3 cut(s) 6, 316, 584
CviAII CATG 6 cut(s) 75, 242, 308, 338, 426, 470
CviQI GTAC 3 cut(s) 6, 316, 584
DdeI CTNAG 4 cut(s) 148, 154, 237, 610
DpnI GATC 3 cut(s) 88, 99, 120
DpnII GATC 3 cut(s) 86, 97, 118
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
Eco147I AGGCCT 1 cut(s) 496
Eco32I GATATC 1 cut(s) 434
Eco47I GGWCC 2 cut(s) 245, 559
Eco81I CCTNAGG 1 cut(s) 154
EcoNI CCTNNNNNAGG 1 cut(s) 405
EcoO109I RGGNCCY 1 cut(s) 559
EcoRI GAATTC 1 cut(s) 360
EcoRII CCWGG 1 cut(s) 569
EcoRV GATATC 1 cut(s) 434
FaeI CATG 6 cut(s) 78, 245, 311, 341, 429, 473
FaqI GGGAC 2 cut(s) 488, 545
FatI CATG 6 cut(s) 74, 241, 307, 337, 425, 469
FauNDI CATATG 1 cut(s) 293
FbaI TGATCA 2 cut(s) 86, 97
FblI GTMKAC 1 cut(s) 162
Fnu4HI GCNGC 6 cut(s) 46, 49, 200, 616, 625, 640
FokI GGATG 1 cut(s) 27
Fsp4HI GCNGC 6 cut(s) 46, 49, 200, 616, 625, 640
FspBI CTAG 1 cut(s) 393
FspI TGCGCA 1 cut(s) 643
GlaI GCGC 1 cut(s) 643
GluI GCNGC 6 cut(s) 46, 49, 200, 616, 625, 640
GsuI CTGGAG 1 cut(s) 342
HaeIII GGCC 1 cut(s) 496
HgaI GACGC 1 cut(s) 51
HhaI GCGC 1 cut(s) 644
Hin1II CATG 6 cut(s) 78, 245, 311, 341, 429, 473
Hin6I GCGC 1 cut(s) 642
HinP1I GCGC 1 cut(s) 642
HincII GTYRAC 2 cut(s) 113, 163
HindII GTYRAC 2 cut(s) 113, 163
HinfI GANTC 2 cut(s) 159, 396
HphI GGTGA 2 cut(s) 207, 586
Hpy166II GTNNAC 4 cut(s) 113, 163, 318, 594
Hpy188I TCNGA 1 cut(s) 518
Hpy188III TCNNGA 6 cut(s) 156, 308, 371, 393, 426, 459
Hpy8I GTNNAC 4 cut(s) 113, 163, 318, 594
HpyAV CCTTC 1 cut(s) 568
HpyCH4III ACNGT 1 cut(s) 21
HpyCH4V TGCA 5 cut(s) 132, 199, 252, 341, 483
HpyF10VI GCNNNNNNNGC 7 cut(s) 54, 347, 480, 615, 621, 624, 648
HpyF3I CTNAG 4 cut(s) 148, 154, 237, 610
Hsp92II CATG 6 cut(s) 78, 245, 311, 341, 429, 473
HspAI GCGC 1 cut(s) 642
KflI GGGWCCC 1 cut(s) 559
Ksp22I TGATCA 2 cut(s) 86, 97
Kzo9I GATC 3 cut(s) 86, 97, 118
LmnI GCTCC 1 cut(s) 233
Lsp1109I GCAGC 6 cut(s) 57, 60, 211, 611, 626, 627
MaeI CTAG 1 cut(s) 393
MalI GATC 3 cut(s) 88, 99, 120
MboI GATC 3 cut(s) 86, 97, 118
MboII GAAGA 5 cut(s) 42, 369, 381, 551, 668
MluCI AATT 3 cut(s) 177, 282, 360
MlyI GAGTC 1 cut(s) 168
MseI TTAA 2 cut(s) 499, 661
MslI CAYNNNNRTG 2 cut(s) 62, 79
MspCI CTTAAG 1 cut(s) 498
MspR9I CCNGG 1 cut(s) 571
Mva1269I GAATGC 1 cut(s) 57
MvaI CCWGG 1 cut(s) 571
MwoI GCNNNNNNNGC 7 cut(s) 54, 347, 480, 615, 621, 624, 648
NdeI CATATG 1 cut(s) 293
NdeII GATC 3 cut(s) 86, 97, 118
NlaIII CATG 6 cut(s) 78, 245, 311, 341, 429, 473
NlaIV GGNNCC 3 cut(s) 125, 560, 561
NsbI TGCGCA 1 cut(s) 643
NspI RCATGY 1 cut(s) 341
PagI TCATGA 2 cut(s) 307, 425
PceI AGGCCT 1 cut(s) 496
PctI GAATGC 1 cut(s) 57
PfeI GAWTC 1 cut(s) 396
Pfl23II CGTACG 1 cut(s) 583
PkrI GCNGC 6 cut(s) 47, 50, 201, 617, 626, 641
PleI GAGTC 1 cut(s) 167
PpsI GAGTC 1 cut(s) 167
PpuMI RGGWCCY 1 cut(s) 559
Psp5II RGGWCCY 1 cut(s) 559
Psp6I CCWGG 1 cut(s) 569
PspGI CCWGG 1 cut(s) 569
PspLI CGTACG 1 cut(s) 583
PspN4I GGNNCC 3 cut(s) 125, 560, 561
PspPI GGNCC 2 cut(s) 245, 559
PspPPI RGGWCCY 1 cut(s) 559
PstI CTGCAG 1 cut(s) 201
RsaI GTAC 3 cut(s) 7, 317, 585
RsaNI GTAC 3 cut(s) 6, 316, 584
RseI CAYNNNNRTG 2 cut(s) 62, 79
SalI GTCGAC 1 cut(s) 161
SaqAI TTAA 2 cut(s) 499, 661
SatI GCNGC 6 cut(s) 46, 49, 200, 616, 625, 640
Sau3AI GATC 3 cut(s) 86, 97, 118
Sau96I GGNCC 2 cut(s) 245, 559
SchI GAGTC 1 cut(s) 168
ScrFI CCNGG 1 cut(s) 571
SetI ASST 7 cut(s) 204, 250, 317, 330, 579, 620, 626
SfcI CTRYAG 1 cut(s) 197
SinI GGWCC 2 cut(s) 245, 559
SmiMI CAYNNNNRTG 2 cut(s) 62, 79
SmlI CTYRAG 2 cut(s) 457, 498
SmoI CTYRAG 2 cut(s) 457, 498
Sse9I AATT 3 cut(s) 177, 282, 360
SseBI AGGCCT 1 cut(s) 496
SsiI CCGC 1 cut(s) 627
SspI AATATT 2 cut(s) 440, 554
SspMI CTAG 1 cut(s) 393
StuI AGGCCT 1 cut(s) 496
StyD4I CCNGG 1 cut(s) 569
TaaI ACNGT 1 cut(s) 21
TaqI TCGA 4 cut(s) 162, 267, 406, 530
TasI AATT 3 cut(s) 177, 282, 360
TatI WGTACW 1 cut(s) 5
TfiI GAWTC 1 cut(s) 396
Tru1I TTAA 2 cut(s) 499, 661
Tru9I TTAA 2 cut(s) 499, 661
TscAI CASTG 3 cut(s) 201, 325, 481
TseI GCWGC 6 cut(s) 45, 48, 199, 615, 624, 639
TspDTI ATGAA 4 cut(s) 63, 296, 370, 414
TspGWI ACGGA 1 cut(s) 551
TspRI CASTG 3 cut(s) 201, 325, 481
Vha464I CTTAAG 1 cut(s) 498
VpaK11BI GGWCC 2 cut(s) 245, 559
XagI CCTNNNNNAGG 1 cut(s) 405
XapI RAATTY 1 cut(s) 360
XbaI TCTAGA 1 cut(s) 392
XceI RCATGY 1 cut(s) 341
XmiI GTMKAC 1 cut(s) 162
XspI CTAG 1 cut(s) 393
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.