Rmu_sc0000784.1_g000025

RRP12-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000784.1
Physical Location & Seq
Forward (+)
101442 .. 101756
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000784.1_g000025.1.cds

Sequence Viewer

Length: 315 bp
atggaccttgcatttgaagttgtttcaacaatgtttgataaattaggggcatacgcttcttacttcatgaggggcacgctagagaacttggcagacatgcacaagttgcctgatgaagacttcccgtttaggaagcaggccactcttcttctaggatcccttgtcgaggagaaatgtgggctaaatgatgttaatattactactgtcctgcctcaaggacaactcagggaagtagggaactgcttgcagattttaggggccttaaatgcatatcaaggtcggaactttctcatcgaaaacagaagatgggattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.8

Weight (kDa)

4.89

Isoelectric Point (pI)

54.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 150, 163
AfiI CCNNNNNNNGG 1 cut(s) 166
AgsI TTSAA 2 cut(s) 17, 27
AlwI GGATC 2 cut(s) 150, 163
AoxI GGCC 2 cut(s) 138, 258
ArsI GACNNNNNNTTYG 1 cut(s) 28
AspS9I GGNCC 2 cut(s) 4, 258
AvaII GGWCC 1 cut(s) 4
BaeGI GKGCMC 1 cut(s) 77
BamHI GGATCC 1 cut(s) 155
BbsI GAAGAC 1 cut(s) 123
BccI CCATC 1 cut(s) 300
BfaI CTAG 2 cut(s) 80, 152
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 258
BmiI GGNNCC 2 cut(s) 157, 259
BpiI GAAGAC 1 cut(s) 123
BpuEI CTTGAG 1 cut(s) 198
Bsc4I CCNNNNNNNGG 1 cut(s) 166
BseLI CCNNNNNNNGG 1 cut(s) 166
BseMII CTCAG 1 cut(s) 238
BseRI GAGGAG 1 cut(s) 182
BseSI GKGCMC 1 cut(s) 77
BshFI GGCC 2 cut(s) 140, 260
BslI CCNNNNNNNGG 1 cut(s) 166
BsnI GGCC 2 cut(s) 140, 260
Bsp1286I GDGCHC 1 cut(s) 77
Bsp143I GATC 1 cut(s) 155
BspANI GGCC 2 cut(s) 140, 260
BspCNI CTCAG 1 cut(s) 237
BspHI TCATGA 1 cut(s) 66
BspLI GGNNCC 2 cut(s) 157, 259
BspPI GGATC 2 cut(s) 150, 163
BssMI GATC 1 cut(s) 155
Bst4CI ACNGT 1 cut(s) 205
Bst6I CTCTTC 1 cut(s) 150
BstAPI GCANNNNNTGC 1 cut(s) 106
BstC8I GCNNGC 3 cut(s) 77, 138, 245
BstDEI CTNAG 1 cut(s) 224
BstENI CCTNNNNNAGG 1 cut(s) 164
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BstMWI GCNNNNNNNGC 2 cut(s) 106, 266
BstNSI RCATGY 1 cut(s) 100
BstSLI GKGCMC 1 cut(s) 77
BstV2I GAAGAC 1 cut(s) 123
BstX2I RGATCY 1 cut(s) 155
BstYI RGATCY 1 cut(s) 155
BsuRI GGCC 2 cut(s) 140, 260
Cac8I GCNNGC 3 cut(s) 77, 138, 245
CciI TCATGA 1 cut(s) 66
Cfr13I GGNCC 2 cut(s) 4, 258
CviAII CATG 2 cut(s) 67, 97
CviJI RGCY 3 cut(s) 140, 181, 260
CviKI_1 RGCY 3 cut(s) 140, 181, 260
DdeI CTNAG 1 cut(s) 224
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 4
EcoNI CCTNNNNNAGG 1 cut(s) 164
EcoO109I RGGNCCY 1 cut(s) 258
EcoT22I ATGCAT 1 cut(s) 271
FaeI CATG 2 cut(s) 70, 100
FaiI YATR 4 cut(s) 52, 68, 98, 271
FatI CATG 2 cut(s) 66, 96
FspBI CTAG 2 cut(s) 80, 152
HaeIII GGCC 2 cut(s) 140, 260
Hin1II CATG 2 cut(s) 70, 100
Hpy188I TCNGA 1 cut(s) 282
Hpy188III TCNNGA 1 cut(s) 67
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4V TGCA 4 cut(s) 11, 100, 247, 269
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 266
HpyF3I CTNAG 1 cut(s) 224
Hsp92II CATG 2 cut(s) 70, 100
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 4 cut(s) 122, 123, 211, 221
MaeI CTAG 2 cut(s) 80, 152
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 4 cut(s) 128, 137, 140, 315
MflI RGATCY 1 cut(s) 155
MhlI GDGCHC 1 cut(s) 77
MluCI AATT 1 cut(s) 41
MmeI TCCRAC 1 cut(s) 260
MnlI CCTC 3 cut(s) 63, 160, 222
Mph1103I ATGCAT 1 cut(s) 271
MseI TTAA 3 cut(s) 192, 263, 313
MwoI GCNNNNNNNGC 2 cut(s) 106, 266
NdeII GATC 1 cut(s) 155
NlaIII CATG 2 cut(s) 70, 100
NlaIV GGNNCC 2 cut(s) 157, 259
NsiI ATGCAT 1 cut(s) 271
NspI RCATGY 1 cut(s) 100
PagI TCATGA 1 cut(s) 66
PspN4I GGNNCC 2 cut(s) 157, 259
PspPI GGNCC 2 cut(s) 4, 258
PsuI RGATCY 1 cut(s) 155
SaqAI TTAA 3 cut(s) 192, 263, 313
Sau3AI GATC 1 cut(s) 155
Sau96I GGNCC 2 cut(s) 4, 258
SduI GDGCHC 1 cut(s) 77
SetI ASST 2 cut(s) 9, 280
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 213
SmoI CTYRAG 1 cut(s) 213
Sse9I AATT 1 cut(s) 41
SspI AATATT 1 cut(s) 196
SspMI CTAG 2 cut(s) 80, 152
TaaI ACNGT 1 cut(s) 205
TaqI TCGA 2 cut(s) 165, 294
TasI AATT 1 cut(s) 41
Tru1I TTAA 3 cut(s) 192, 263, 313
Tru9I TTAA 3 cut(s) 192, 263, 313
TspDTI ATGAA 2 cut(s) 55, 129
VpaK11BI GGWCC 1 cut(s) 4
XagI CCTNNNNNAGG 1 cut(s) 164
XceI RCATGY 1 cut(s) 100
XspI CTAG 2 cut(s) 80, 152
Zsp2I ATGCAT 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.