Rh2DG259700

RRP12-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
27893686 .. 27894189
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG259700.1

Sequence Viewer

Length: 504 bp
ATGCTGTGTTTTATAGTTCAAAGCTTACTTGGTTATCACCGCACAAATGCTCCTGCTCTCAGCAAGGACCTTGCATTTGAAGTTGTTTCAACAATGTTTGATAAATTAGGGGCATACGCTTCTTACTTCATGAGGGGCACGCTGGAGAACTTGGCAGACATGCACAAGTTGCCTGATGAAGACTTCCCGTTTAGGAAGCTGGCCACTCTTCTTCTAGGATCGCTTGTCGAGGAGAAATGTGGGCTAAATGATGTTAATATTACTGCTGTCCTGCCTCAAGGACAACTCAGGGAACTGCTTGCAGATTCTAGGGGACTTAAAGGCATATCAAGGTTGGAACTTTCTCATCGAAAATGGAAGATGGAGTTAAATATTGAGCCCTTTCTAGGAAGGGACTGGTCAGAGGAGATGAGGGCTGAGGAAGCTACAATTACAGCCATATCTGGTGTTGCGCAAATGACAAAGATTCAAAGAAGATTAAACTCGATAACCAGGCTTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

167

Amino Acids

18.88

Weight (kDa)

6.84

Isoelectric Point (pI)

46.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 453
AciI CCGC 1 cut(s) 40
AclWI GGATC 1 cut(s) 226
AcoI YGGCCR 1 cut(s) 201
AfiI CCNNNNNNNGG 1 cut(s) 386
AgsI TTSAA 4 cut(s) 20, 80, 90, 470
AjnI CCWGG 1 cut(s) 491
AluBI AGCT 3 cut(s) 24, 199, 425
AluI AGCT 3 cut(s) 24, 199, 425
AlwI GGATC 1 cut(s) 226
AoxI GGCC 1 cut(s) 201
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
AspLEI GCGC 1 cut(s) 454
AspS9I GGNCC 1 cut(s) 67
AsuHPI GGTGA 1 cut(s) 29
AvaII GGWCC 1 cut(s) 67
BaeGI GKGCMC 1 cut(s) 140
BalI TGGCCA 1 cut(s) 203
BanII GRGCYC 1 cut(s) 381
BbsI GAAGAC 1 cut(s) 186
BbvCI CCTCAGC 1 cut(s) 417
BccI CCATC 1 cut(s) 355
BciT130I CCWGG 1 cut(s) 493
BfaI CTAG 3 cut(s) 215, 309, 386
Bme1390I CCNGG 1 cut(s) 493
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BmrFI CCNGG 1 cut(s) 493
BpiI GAAGAC 1 cut(s) 186
BpmI CTGGAG 1 cut(s) 164
Bpu10I CCTNAGC 1 cut(s) 417
BpuEI CTTGAG 1 cut(s) 261
BsaXI ACNNNNNCTCC 2 cut(s) 34, 64
Bsc4I CCNNNNNNNGG 1 cut(s) 386
Bse1I ACTGG 1 cut(s) 401
BseBI CCWGG 1 cut(s) 493
BseLI CCNNNNNNNGG 1 cut(s) 386
BseMII CTCAG 3 cut(s) 73, 301, 408
BseNI ACTGG 1 cut(s) 401
BseRI GAGGAG 2 cut(s) 245, 419
BseSI GKGCMC 1 cut(s) 140
BshFI GGCC 1 cut(s) 203
BslFI GGGAC 2 cut(s) 327, 407
BslI CCNNNNNNNGG 1 cut(s) 386
BsmFI GGGAC 2 cut(s) 327, 407
BsnI GGCC 1 cut(s) 203
Bsp1286I GDGCHC 2 cut(s) 140, 381
Bsp143I GATC 1 cut(s) 218
BspACI CCGC 1 cut(s) 40
BspANI GGCC 1 cut(s) 203
BspCNI CTCAG 3 cut(s) 72, 300, 409
BspHI TCATGA 1 cut(s) 129
BspPI GGATC 1 cut(s) 226
BsrI ACTGG 1 cut(s) 401
BssMI GATC 1 cut(s) 218
Bst2UI CCWGG 1 cut(s) 493
Bst6I CTCTTC 1 cut(s) 213
BstAPI GCANNNNNTGC 1 cut(s) 169
BstC8I GCNNGC 3 cut(s) 140, 201, 300
BstDEI CTNAG 3 cut(s) 59, 287, 417
BstHHI GCGC 1 cut(s) 454
BstKTI GATC 1 cut(s) 221
BstMBI GATC 1 cut(s) 218
BstMWI GCNNNNNNNGC 2 cut(s) 169, 422
BstNI CCWGG 1 cut(s) 493
BstNSI RCATGY 1 cut(s) 163
BstSCI CCNGG 1 cut(s) 491
BstSLI GKGCMC 1 cut(s) 140
BstV2I GAAGAC 1 cut(s) 186
BsuRI GGCC 1 cut(s) 203
Cac8I GCNNGC 3 cut(s) 140, 201, 300
CciI TCATGA 1 cut(s) 129
CfoI GCGC 1 cut(s) 454
Cfr13I GGNCC 1 cut(s) 67
CviAII CATG 2 cut(s) 130, 160
CviJI RGCY 9 cut(s) 24, 199, 203, 244, 379, 416, 425, 437, 496
CviKI_1 RGCY 9 cut(s) 24, 199, 203, 244, 379, 416, 425, 437, 496
DdeI CTNAG 3 cut(s) 59, 287, 417
DpnI GATC 1 cut(s) 220
DpnII GATC 1 cut(s) 218
EaeI YGGCCR 1 cut(s) 201
Eam1104I CTCTTC 1 cut(s) 213
EarI CTCTTC 1 cut(s) 213
Eco24I GRGCYC 1 cut(s) 381
Eco47I GGWCC 1 cut(s) 67
EcoO109I RGGNCCY 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 491
EcoT38I GRGCYC 1 cut(s) 381
FaeI CATG 2 cut(s) 133, 163
FaiI YATR 6 cut(s) 14, 115, 131, 161, 326, 440
FaqI GGGAC 2 cut(s) 327, 407
FatI CATG 2 cut(s) 129, 159
FriOI GRGCYC 1 cut(s) 381
FspBI CTAG 3 cut(s) 215, 309, 386
FspI TGCGCA 1 cut(s) 453
GlaI GCGC 1 cut(s) 453
GsuI CTGGAG 1 cut(s) 164
HaeIII GGCC 1 cut(s) 203
HhaI GCGC 1 cut(s) 454
Hin1II CATG 2 cut(s) 133, 163
Hin6I GCGC 1 cut(s) 452
HinP1I GCGC 1 cut(s) 452
HindIII AAGCTT 1 cut(s) 22
HinfI GANTC 2 cut(s) 305, 466
HphI GGTGA 1 cut(s) 29
Hpy188I TCNGA 1 cut(s) 403
Hpy188III TCNNGA 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 384
HpyCH4V TGCA 3 cut(s) 74, 163, 302
HpyF10VI GCNNNNNNNGC 2 cut(s) 169, 422
HpyF3I CTNAG 3 cut(s) 59, 287, 417
Hsp92II CATG 2 cut(s) 133, 163
HspAI GCGC 1 cut(s) 452
Kzo9I GATC 1 cut(s) 218
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 9 cut(s) 66, 128, 185, 186, 274, 284, 382, 429, 478
MaeI CTAG 3 cut(s) 215, 309, 386
MalI GATC 1 cut(s) 220
MboI GATC 1 cut(s) 218
MboII GAAGA 5 cut(s) 191, 200, 203, 370, 486
MhlI GDGCHC 2 cut(s) 140, 381
MlsI TGGCCA 1 cut(s) 203
MluCI AATT 2 cut(s) 104, 429
MluNI TGGCCA 1 cut(s) 203
MmeI TCCRAC 1 cut(s) 315
MnlI CCTC 6 cut(s) 126, 223, 285, 397, 405, 412
Mox20I TGGCCA 1 cut(s) 203
MscI TGGCCA 1 cut(s) 203
MseI TTAA 5 cut(s) 255, 318, 368, 479, 502
Msp20I TGGCCA 1 cut(s) 203
MspR9I CCNGG 1 cut(s) 493
MvaI CCWGG 1 cut(s) 493
MwoI GCNNNNNNNGC 2 cut(s) 169, 422
NdeII GATC 1 cut(s) 218
NlaIII CATG 2 cut(s) 133, 163
NsbI TGCGCA 1 cut(s) 453
NspI RCATGY 1 cut(s) 163
PagI TCATGA 1 cut(s) 129
PfeI GAWTC 2 cut(s) 305, 466
PpuMI RGGWCCY 1 cut(s) 67
Psp5II RGGWCCY 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 491
PspGI CCWGG 1 cut(s) 491
PspPI GGNCC 1 cut(s) 67
PspPPI RGGWCCY 1 cut(s) 67
SaqAI TTAA 5 cut(s) 255, 318, 368, 479, 502
Sau3AI GATC 1 cut(s) 218
Sau96I GGNCC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 493
SduI GDGCHC 2 cut(s) 140, 381
SetI ASST 5 cut(s) 26, 72, 201, 335, 427
SinI GGWCC 1 cut(s) 67
SmlI CTYRAG 1 cut(s) 276
SmoI CTYRAG 1 cut(s) 276
Sse9I AATT 2 cut(s) 104, 429
SsiI CCGC 1 cut(s) 40
SspI AATATT 2 cut(s) 259, 373
SspMI CTAG 3 cut(s) 215, 309, 386
StyD4I CCNGG 1 cut(s) 491
TaqI TCGA 3 cut(s) 228, 349, 485
TasI AATT 2 cut(s) 104, 429
TfiI GAWTC 2 cut(s) 305, 466
Tru1I TTAA 5 cut(s) 255, 318, 368, 479, 502
Tru9I TTAA 5 cut(s) 255, 318, 368, 479, 502
TspDTI ATGAA 2 cut(s) 118, 192
VpaK11BI GGWCC 1 cut(s) 67
XceI RCATGY 1 cut(s) 163
XspI CTAG 3 cut(s) 215, 309, 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.