FvH4_3g11030

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
6504564 .. 6506712
2149 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g11030.t1

Sequence Viewer

Length: 750 bp
ATGGCCTTCTCCTCTATGCGGAATCTGGCTCGGTCAGGCGTCAGTCTTCCCTTATTGAGAACCCAGCTTGAAAGGACCCAGTTCGTCAGGTCCTTTTGGAAGGGAAGCAGAGGGCGATTGGAAAAAGGTATGCAAGAGAAGTTGAAGTACTTGATTGACCAGGGAGTTAAAATAGAAATGGTGGAAGATAAGAACCAGCCAGTAGGGAAGTATACCTTAGAAATGCATCCCTACACTATGGAGGTAATACAAGTTTGGGCCAAACAATTAAAGATTTTAGGGATGTTGACTGATCTTCACATTCTTGCTGAAACCAAGTTGACTTTGCGTGAGTCCGGGTTGTTGGCGTCCCTATACAAGCACGGCCCAAATGACACTTGGAGAGCTGTAGCTCAGAGAATCAAAGGGAAAACTACTAGATCTGTTTATGAACTGAAGACAGTTGAGACACGGCTGGATGAGATTCGAGCATTGGCAAAAGAAATATCTACAGTTCTCATTGTTTATCAGAAACAAAAGAAGACAGCATTACAACCCAAAGACAATAGGACAGAGGTCCTTCCCCATGACTTTGGATCCATTTTGATCAAGCTTTCTCAACTTCGTTTGAAATGGAAAGCTATTGCCTCTTTGGAAAGTGCGACCTTGTTGGATGATTCTGAGATGGATGAATTGGTTGAGATAGAAGCGACAATCAAAGAAGTGCATAATATTGTGGTTGTCCAACAACTGTTGGAAAAAGATGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

250

Amino Acids

28.6

Weight (kDa)

9.4

Isoelectric Point (pI)

35.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 212
AciI CCGC 1 cut(s) 19
AclWI GGATC 2 cut(s) 570, 583
AcuI CTGAAG 1 cut(s) 455
AcyI GRCGYC 2 cut(s) 39, 347
AfaI GTAC 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 18
AgsI TTSAA 3 cut(s) 71, 145, 610
AjnI CCWGG 1 cut(s) 159
AluBI AGCT 5 cut(s) 67, 386, 392, 592, 620
AluI AGCT 5 cut(s) 67, 386, 392, 592, 620
Alw26I GTCTC 1 cut(s) 440
AlwI GGATC 2 cut(s) 570, 583
AoxI GGCC 3 cut(s) 3, 258, 364
AspS9I GGNCC 5 cut(s) 75, 90, 258, 365, 556
AsuC2I CCSGG 1 cut(s) 337
AvaII GGWCC 3 cut(s) 75, 90, 556
BamHI GGATCC 1 cut(s) 575
BarI GAAGNNNNNNTAC 2 cut(s) 131, 163
BbsI GAAGAC 3 cut(s) 38, 443, 527
BccI CCATC 1 cut(s) 658
BceAI ACGGC 2 cut(s) 379, 467
BciT130I CCWGG 1 cut(s) 161
BclI TGATCA 1 cut(s) 585
BcnI CCSGG 1 cut(s) 337
BcoDI GTCTC 1 cut(s) 440
BfaI CTAG 1 cut(s) 417
BfmI CTRYAG 2 cut(s) 387, 489
BglII AGATCT 1 cut(s) 419
BmcAI AGTACT 1 cut(s) 149
Bme1390I CCNGG 2 cut(s) 161, 337
Bme18I GGWCC 3 cut(s) 75, 90, 556
BmgT120I GGNCC 5 cut(s) 75, 90, 258, 365, 556
BmiI GGNNCC 2 cut(s) 77, 577
BmrFI CCNGG 2 cut(s) 161, 337
BmrI ACTGGG 1 cut(s) 73
BmsI GCATC 1 cut(s) 235
BmuI ACTGGG 1 cut(s) 73
BoxI GACNNNNGTC 1 cut(s) 554
BpiI GAAGAC 3 cut(s) 38, 443, 527
BpuMI CCSGG 1 cut(s) 337
BsaHI GRCGYC 2 cut(s) 39, 347
BsaJI CCNNGG 1 cut(s) 160
Bsc4I CCNNNNNNNGG 1 cut(s) 18
Bse1I ACTGG 2 cut(s) 79, 200
BseBI CCWGG 1 cut(s) 161
BseDI CCNNGG 1 cut(s) 160
BseGI GGATG 5 cut(s) 226, 288, 463, 658, 673
BseLI CCNNNNNNNGG 1 cut(s) 18
BseMII CTCAG 2 cut(s) 407, 651
BseNI ACTGG 2 cut(s) 79, 200
BseYI CCCAGC 1 cut(s) 63
BshFI GGCC 3 cut(s) 5, 260, 366
BsiSI CCGG 1 cut(s) 336
BslFI GGGAC 1 cut(s) 334
BslI CCNNNNNNNGG 1 cut(s) 18
BsmAI GTCTC 1 cut(s) 440
BsmFI GGGAC 1 cut(s) 334
BsnI GGCC 3 cut(s) 5, 260, 366
Bsp143I GATC 4 cut(s) 292, 419, 575, 585
BspACI CCGC 1 cut(s) 19
BspANI GGCC 3 cut(s) 5, 260, 366
BspCNI CTCAG 2 cut(s) 406, 652
BspLI GGNNCC 2 cut(s) 77, 577
BspPI GGATC 2 cut(s) 570, 583
BsrI ACTGG 2 cut(s) 79, 200
BssECI CCNNGG 1 cut(s) 160
BssMI GATC 4 cut(s) 292, 419, 575, 585
BssNAI GTATAC 1 cut(s) 213
BssNI GRCGYC 2 cut(s) 39, 347
Bst1107I GTATAC 1 cut(s) 213
Bst2UI CCWGG 1 cut(s) 161
Bst4CI ACNGT 3 cut(s) 442, 493, 732
BstACI GRCGYC 2 cut(s) 39, 347
BstDEI CTNAG 3 cut(s) 217, 393, 660
BstF5I GGATG 5 cut(s) 226, 288, 463, 658, 673
BstKTI GATC 4 cut(s) 295, 422, 578, 588
BstMAI GTCTC 1 cut(s) 440
BstMBI GATC 4 cut(s) 292, 419, 575, 585
BstNI CCWGG 1 cut(s) 161
BstPAI GACNNNNGTC 1 cut(s) 554
BstSCI CCNGG 2 cut(s) 159, 335
BstSFI CTRYAG 2 cut(s) 387, 489
BstV2I GAAGAC 3 cut(s) 38, 443, 527
BstX2I RGATCY 2 cut(s) 419, 575
BstXI CCANNNNNNTGG 1 cut(s) 572
BstYI RGATCY 2 cut(s) 419, 575
BstZ17I GTATAC 1 cut(s) 213
BsuRI GGCC 3 cut(s) 5, 260, 366
BtsCI GGATG 5 cut(s) 226, 288, 463, 658, 673
Cfr13I GGNCC 5 cut(s) 75, 90, 258, 365, 556
CseI GACGC 2 cut(s) 28, 336
Csp6I GTAC 1 cut(s) 148
CviAII CATG 1 cut(s) 566
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 3 cut(s) 217, 393, 660
DpnI GATC 4 cut(s) 294, 421, 577, 587
DpnII GATC 4 cut(s) 292, 419, 575, 585
Eco47I GGWCC 3 cut(s) 75, 90, 556
Eco57I CTGAAG 1 cut(s) 455
EcoO109I RGGNCCY 3 cut(s) 75, 90, 556
EcoRII CCWGG 1 cut(s) 159
EcoT22I ATGCAT 1 cut(s) 228
FaeI CATG 1 cut(s) 569
FaiI YATR 8 cut(s) 17, 131, 213, 239, 355, 429, 567, 708
FalI AAGNNNNNCTT 2 cut(s) 200, 232
FaqI GGGAC 1 cut(s) 334
FatI CATG 1 cut(s) 565
FbaI TGATCA 1 cut(s) 585
FblI GTMKAC 1 cut(s) 212
FokI GGATG 5 cut(s) 213, 295, 470, 665, 680
FspBI CTAG 1 cut(s) 417
GsaI CCCAGC 1 cut(s) 67
HaeIII GGCC 3 cut(s) 5, 260, 366
HapII CCGG 1 cut(s) 336
HgaI GACGC 2 cut(s) 28, 336
Hin1I GRCGYC 2 cut(s) 39, 347
Hin1II CATG 1 cut(s) 569
HincII GTYRAC 2 cut(s) 288, 321
HindII GTYRAC 2 cut(s) 288, 321
HindIII AAGCTT 1 cut(s) 590
HinfI GANTC 5 cut(s) 22, 332, 399, 463, 656
HpaII CCGG 1 cut(s) 336
Hpy166II GTNNAC 3 cut(s) 213, 288, 321
Hpy188I TCNGA 3 cut(s) 396, 510, 661
Hpy8I GTNNAC 3 cut(s) 213, 288, 321
HpyAV CCTTC 3 cut(s) 16, 94, 569
HpyCH4III ACNGT 3 cut(s) 442, 493, 732
HpyCH4V TGCA 3 cut(s) 133, 226, 706
HpyF3I CTNAG 3 cut(s) 217, 393, 660
Hsp92I GRCGYC 2 cut(s) 39, 347
Hsp92II CATG 1 cut(s) 569
Ksp22I TGATCA 1 cut(s) 585
Kzo9I GATC 4 cut(s) 292, 419, 575, 585
LweI GCATC 1 cut(s) 235
MaeI CTAG 1 cut(s) 417
MalI GATC 4 cut(s) 294, 421, 577, 587
MboI GATC 4 cut(s) 292, 419, 575, 585
MboII GAAGA 5 cut(s) 38, 197, 287, 448, 532
MflI RGATCY 2 cut(s) 419, 575
MluCI AATT 2 cut(s) 266, 671
MlyI GAGTC 1 cut(s) 341
MmeI TCCRAC 3 cut(s) 630, 714, 748
MnlI CCTC 5 cut(s) 22, 104, 235, 547, 637
Mph1103I ATGCAT 1 cut(s) 228
MseI TTAA 2 cut(s) 168, 269
MspI CCGG 1 cut(s) 336
MspR9I CCNGG 2 cut(s) 161, 337
MvaI CCWGG 1 cut(s) 161
NciI CCSGG 1 cut(s) 337
NdeII GATC 4 cut(s) 292, 419, 575, 585
NlaIII CATG 1 cut(s) 569
NlaIV GGNNCC 2 cut(s) 77, 577
NsiI ATGCAT 1 cut(s) 228
PfeI GAWTC 4 cut(s) 22, 399, 463, 656
PleI GAGTC 1 cut(s) 340
PpsI GAGTC 1 cut(s) 340
PpuMI RGGWCCY 3 cut(s) 75, 90, 556
PshAI GACNNNNGTC 1 cut(s) 554
Psp5II RGGWCCY 3 cut(s) 75, 90, 556
Psp6I CCWGG 1 cut(s) 159
PspFI CCCAGC 1 cut(s) 63
PspGI CCWGG 1 cut(s) 159
PspN4I GGNNCC 2 cut(s) 77, 577
PspPI GGNCC 5 cut(s) 75, 90, 258, 365, 556
PspPPI RGGWCCY 3 cut(s) 75, 90, 556
PsuI RGATCY 2 cut(s) 419, 575
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 2 cut(s) 168, 269
Sau3AI GATC 4 cut(s) 292, 419, 575, 585
Sau96I GGNCC 5 cut(s) 75, 90, 258, 365, 556
ScaI AGTACT 1 cut(s) 149
SchI GAGTC 1 cut(s) 341
ScrFI CCNGG 2 cut(s) 161, 337
SfaNI GCATC 1 cut(s) 235
SfcI CTRYAG 2 cut(s) 387, 489
SinI GGWCC 3 cut(s) 75, 90, 556
Sse9I AATT 2 cut(s) 266, 671
SsiI CCGC 1 cut(s) 19
SspI AATATT 1 cut(s) 712
SspMI CTAG 1 cut(s) 417
StyD4I CCNGG 2 cut(s) 159, 335
TaaI ACNGT 3 cut(s) 442, 493, 732
TaqI TCGA 1 cut(s) 466
TaqII GACCGA 1 cut(s) 21
TasI AATT 2 cut(s) 266, 671
TatI WGTACW 1 cut(s) 147
TfiI GAWTC 4 cut(s) 22, 399, 463, 656
Tru1I TTAA 2 cut(s) 168, 269
Tru9I TTAA 2 cut(s) 168, 269
TspDTI ATGAA 2 cut(s) 444, 684
VpaK11BI GGWCC 3 cut(s) 75, 90, 556
XcmI CCANNNNNNNNNTGG 1 cut(s) 375
XmiI GTMKAC 1 cut(s) 212
XspI CTAG 1 cut(s) 417
ZrmI AGTACT 1 cut(s) 149
Zsp2I ATGCAT 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.