Rh5CG141800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000731
Physical Location & Seq
Forward (+)
12535354 .. 12535647
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG141800.1

Sequence Viewer

Length: 294 bp
ATGGAGAAATGGTTGGACCATGTAGAGCCTTTGGCAAAAGAAATATATCAGGTGCTGGTTGTTCGTCACGGACAGAAAGTCTCCAAGCCTCAAGGAGAACATCATTTTGAAATTCTTCCCAACAGTTTTGGTTCGATTCTGATTGAGCTCTCAAAGCTTCGGTTGAAAGCTATTGCATCCTTGGAGCATGGAAACTTGTTGGATGAATTAGACAAGCGAGAACTTGATTATGTAGAGACTTTGATCAAGGAAGTACACTACTTTGTGGTCGTTCAGCAAGTATTGCTAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.31

Weight (kDa)

5.64

Isoelectric Point (pI)

30.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 111
AfaI GTAC 1 cut(s) 255
AgsI TTSAA 2 cut(s) 110, 166
AhdI GACNNNNNGTC 1 cut(s) 77
AluBI AGCT 3 cut(s) 148, 157, 170
AluI AGCT 3 cut(s) 148, 157, 170
Alw21I GWGCWC 1 cut(s) 150
Alw26I GTCTC 2 cut(s) 85, 230
AlwNI CAGNNNCTG 1 cut(s) 55
ApoI RAATTY 1 cut(s) 111
Asp700I GAANNNNTTC 1 cut(s) 114
AspS9I GGNCC 1 cut(s) 16
AvaII GGWCC 1 cut(s) 16
BanII GRGCYC 1 cut(s) 150
Bbv12I GWGCWC 1 cut(s) 150
BclI TGATCA 1 cut(s) 243
BcoDI GTCTC 2 cut(s) 85, 230
BfaI CTAG 1 cut(s) 287
Bme18I GGWCC 1 cut(s) 16
BmeRI GACNNNNNGTC 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 16
BmsI GCATC 1 cut(s) 185
BpuEI CTTGAG 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 180
BsaXI ACNNNNNCTCC 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 180
BseGI GGATG 2 cut(s) 176, 208
BsiHKAI GWGCWC 1 cut(s) 150
BsmAI GTCTC 2 cut(s) 85, 230
Bsp1286I GDGCHC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 243
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 1 cut(s) 243
BssT1I CCWWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 125
BstAPI GCANNNNNTGC 1 cut(s) 283
BstF5I GGATG 2 cut(s) 176, 208
BstKTI GATC 1 cut(s) 246
BstMAI GTCTC 2 cut(s) 85, 230
BstMBI GATC 1 cut(s) 243
BstMWI GCNNNNNNNGC 2 cut(s) 154, 283
BtsCI GGATG 2 cut(s) 176, 208
CaiI CAGNNNCTG 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 16
Csp6I GTAC 1 cut(s) 254
CviAII CATG 2 cut(s) 20, 188
CviJI RGCY 5 cut(s) 28, 88, 148, 157, 170
CviKI_1 RGCY 5 cut(s) 28, 88, 148, 157, 170
CviQI GTAC 1 cut(s) 254
DpnI GATC 1 cut(s) 245
DpnII GATC 1 cut(s) 243
DriI GACNNNNNGTC 1 cut(s) 77
Eam1105I GACNNNNNGTC 1 cut(s) 77
Ecl136II GAGCTC 1 cut(s) 148
Eco130I CCWWGG 1 cut(s) 180
Eco24I GRGCYC 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 16
Eco53kI GAGCTC 1 cut(s) 148
EcoICRI GAGCTC 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 180
EcoT38I GRGCYC 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 2 cut(s) 23, 191
FaiI YATR 4 cut(s) 21, 46, 189, 231
FatI CATG 2 cut(s) 19, 187
FbaI TGATCA 1 cut(s) 243
FokI GGATG 2 cut(s) 163, 215
FriOI GRGCYC 1 cut(s) 150
FspBI CTAG 1 cut(s) 287
Hin1II CATG 2 cut(s) 23, 191
HindIII AAGCTT 1 cut(s) 155
HinfI GANTC 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 141
Hpy8I GTNNAC 1 cut(s) 256
HpyCH4III ACNGT 1 cut(s) 125
HpyCH4V TGCA 1 cut(s) 176
HpyF10VI GCNNNNNNNGC 2 cut(s) 154, 283
Hsp92II CATG 2 cut(s) 23, 191
Ksp22I TGATCA 1 cut(s) 243
Kzo9I GATC 1 cut(s) 243
LmnI GCTCC 1 cut(s) 184
LpnPI CCDG 2 cut(s) 35, 41
LweI GCATC 1 cut(s) 185
MaeI CTAG 1 cut(s) 287
MaeIII GTNAC 1 cut(s) 65
MalI GATC 1 cut(s) 245
MboI GATC 1 cut(s) 243
MboII GAAGA 1 cut(s) 107
MhlI GDGCHC 1 cut(s) 150
MluCI AATT 2 cut(s) 111, 206
MmeI TCCRAC 1 cut(s) 180
MnlI CCTC 1 cut(s) 99
MroXI GAANNNNTTC 1 cut(s) 114
MwoI GCNNNNNNNGC 2 cut(s) 154, 283
NdeII GATC 1 cut(s) 243
NlaIII CATG 2 cut(s) 23, 191
NmuCI GTSAC 1 cut(s) 65
PdmI GAANNNNTTC 1 cut(s) 114
PfeI GAWTC 1 cut(s) 136
Psp124BI GAGCTC 1 cut(s) 150
PspPI GGNCC 1 cut(s) 16
PstNI CAGNNNCTG 1 cut(s) 55
RsaI GTAC 1 cut(s) 255
RsaNI GTAC 1 cut(s) 254
SacI GAGCTC 1 cut(s) 150
Sau3AI GATC 1 cut(s) 243
Sau96I GGNCC 1 cut(s) 16
SduI GDGCHC 1 cut(s) 150
SetI ASST 4 cut(s) 54, 150, 159, 172
SfaNI GCATC 1 cut(s) 185
SinI GGWCC 1 cut(s) 16
SmlI CTYRAG 1 cut(s) 90
SmoI CTYRAG 1 cut(s) 90
Sse9I AATT 2 cut(s) 111, 206
SspMI CTAG 1 cut(s) 287
SstI GAGCTC 1 cut(s) 150
StyI CCWWGG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 125
TaqI TCGA 1 cut(s) 134
TasI AATT 2 cut(s) 111, 206
TatI WGTACW 1 cut(s) 253
TfiI GAWTC 1 cut(s) 136
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 219
TspGWI ACGGA 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 16
XapI RAATTY 1 cut(s) 111
XmnI GAANNNNTTC 1 cut(s) 114
XspI CTAG 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.