Rmu_sc0009555.1_g000006

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009555.1
Physical Location & Seq
Reverse (-)
23303 .. 23788
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009555.1_g000006.1.cds

Sequence Viewer

Length: 486 bp
atgaaagggagagctaatacttcctccgattcttacttgaaacaggaactcgagaaaatggagaaatggttggaccatgtagagcctttggcaaaagatatatatcaggtgctggttgttcgtcacggacagaaagtctctaagcctcaaggagaacatcattttgaaattcttcccaacagttttgtttcaattctgattaagctctcaaagcttcggttgaaagctattgcatccttggagcatggaaacttgttggatgacttggacaagcgagaacttgattatgtagagactttgatcaaggaagtacacaactttgtggtcgttcagcaagtattgctagaatatataactttggacaccagtaatggtaagacttcagttgacaatggtaacctctttacaaatgattggggcatggttagggttgtttctgattctttttcctggtgctgtgttgtgtatcaaactccttcattttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

161

Amino Acids

18.48

Weight (kDa)

5.84

Isoelectric Point (pI)

15.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 168
AcuI CTGAAG 1 cut(s) 366
AfaI GTAC 1 cut(s) 312
AgsI TTSAA 4 cut(s) 40, 167, 192, 223
AhdI GACNNNNNGTC 1 cut(s) 134
AjnI CCWGG 1 cut(s) 449
AluBI AGCT 4 cut(s) 14, 205, 214, 227
AluI AGCT 4 cut(s) 14, 205, 214, 227
Alw26I GTCTC 2 cut(s) 142, 287
AlwNI CAGNNNCTG 1 cut(s) 112
Ama87I CYCGRG 1 cut(s) 50
ApoI RAATTY 1 cut(s) 168
Asp700I GAANNNNTTC 1 cut(s) 171
AspS9I GGNCC 1 cut(s) 73
AvaI CYCGRG 1 cut(s) 50
AvaII GGWCC 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 451
BclI TGATCA 1 cut(s) 300
BcoDI GTCTC 2 cut(s) 142, 287
BfaI CTAG 1 cut(s) 344
Bme1390I CCNGG 1 cut(s) 451
Bme18I GGWCC 1 cut(s) 73
BmeRI GACNNNNNGTC 1 cut(s) 134
BmeT110I CYCGRG 1 cut(s) 50
BmgT120I GGNCC 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 451
BmsI GCATC 1 cut(s) 242
BpuEI CTTGAG 1 cut(s) 132
BsaBI GATNNNNATC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 237
BsaXI ACNNNNNCTCC 2 cut(s) 53, 83
Bse1I ACTGG 1 cut(s) 366
Bse8I GATNNNNATC 1 cut(s) 102
BseBI CCWGG 1 cut(s) 451
BseDI CCNNGG 1 cut(s) 237
BseGI GGATG 2 cut(s) 233, 265
BseJI GATNNNNATC 1 cut(s) 102
BseNI ACTGG 1 cut(s) 366
BsiHKCI CYCGRG 1 cut(s) 50
BsmAI GTCTC 2 cut(s) 142, 287
BsoBI CYCGRG 1 cut(s) 50
Bsp143I GATC 1 cut(s) 300
BsrI ACTGG 1 cut(s) 366
BssECI CCNNGG 1 cut(s) 237
BssMI GATC 1 cut(s) 300
BssT1I CCWWGG 1 cut(s) 237
Bst2UI CCWGG 1 cut(s) 451
Bst4CI ACNGT 1 cut(s) 182
BstAPI GCANNNNNTGC 1 cut(s) 340
BstDEI CTNAG 1 cut(s) 141
BstEII GGTNACC 1 cut(s) 395
BstF5I GGATG 2 cut(s) 233, 265
BstKTI GATC 1 cut(s) 303
BstMAI GTCTC 2 cut(s) 142, 287
BstMBI GATC 1 cut(s) 300
BstMWI GCNNNNNNNGC 2 cut(s) 211, 340
BstNI CCWGG 1 cut(s) 451
BstPI GGTNACC 1 cut(s) 395
BstSCI CCNGG 1 cut(s) 449
BtsCI GGATG 2 cut(s) 233, 265
CaiI CAGNNNCTG 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 73
Csp6I GTAC 1 cut(s) 311
CviAII CATG 3 cut(s) 77, 245, 421
CviJI RGCY 6 cut(s) 14, 85, 145, 205, 214, 227
CviKI_1 RGCY 6 cut(s) 14, 85, 145, 205, 214, 227
CviQI GTAC 1 cut(s) 311
DdeI CTNAG 1 cut(s) 141
DpnI GATC 1 cut(s) 302
DpnII GATC 1 cut(s) 300
DriI GACNNNNNGTC 1 cut(s) 134
Eam1105I GACNNNNNGTC 1 cut(s) 134
Eco130I CCWWGG 1 cut(s) 237
Eco47I GGWCC 1 cut(s) 73
Eco57I CTGAAG 1 cut(s) 366
Eco88I CYCGRG 1 cut(s) 50
Eco91I GGTNACC 1 cut(s) 395
EcoO65I GGTNACC 1 cut(s) 395
EcoRII CCWGG 1 cut(s) 449
EcoT14I CCWWGG 1 cut(s) 237
ErhI CCWWGG 1 cut(s) 237
FaeI CATG 3 cut(s) 80, 248, 424
FaiI YATR 8 cut(s) 78, 101, 103, 246, 288, 351, 353, 422
FatI CATG 3 cut(s) 76, 244, 420
FbaI TGATCA 1 cut(s) 300
FokI GGATG 2 cut(s) 220, 272
FspBI CTAG 1 cut(s) 344
Hin1II CATG 3 cut(s) 80, 248, 424
HincII GTYRAC 1 cut(s) 388
HindII GTYRAC 1 cut(s) 388
HindIII AAGCTT 1 cut(s) 212
HinfI GANTC 2 cut(s) 29, 440
Hpy166II GTNNAC 2 cut(s) 313, 388
Hpy188I TCNGA 3 cut(s) 28, 198, 439
Hpy188III TCNNGA 1 cut(s) 52
Hpy8I GTNNAC 2 cut(s) 313, 388
HpyAV CCTTC 1 cut(s) 486
HpyCH4III ACNGT 1 cut(s) 182
HpyCH4V TGCA 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 2 cut(s) 211, 340
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 3 cut(s) 80, 248, 424
Ksp22I TGATCA 1 cut(s) 300
Kzo9I GATC 1 cut(s) 300
LmnI GCTCC 1 cut(s) 241
LpnPI CCDG 6 cut(s) 29, 92, 98, 379, 436, 463
LweI GCATC 1 cut(s) 242
MaeI CTAG 1 cut(s) 344
MaeIII GTNAC 2 cut(s) 122, 395
MalI GATC 1 cut(s) 302
MboI GATC 1 cut(s) 300
MboII GAAGA 1 cut(s) 164
MluCI AATT 2 cut(s) 168, 192
MmeI TCCRAC 2 cut(s) 51, 237
MnlI CCTC 3 cut(s) 34, 156, 410
MroXI GAANNNNTTC 1 cut(s) 171
MseI TTAA 1 cut(s) 201
MspR9I CCNGG 1 cut(s) 451
MvaI CCWGG 1 cut(s) 451
MwoI GCNNNNNNNGC 2 cut(s) 211, 340
NdeII GATC 1 cut(s) 300
NlaIII CATG 3 cut(s) 80, 248, 424
NmuCI GTSAC 1 cut(s) 122
PaeR7I CTCGAG 1 cut(s) 50
PdmI GAANNNNTTC 1 cut(s) 171
PfeI GAWTC 2 cut(s) 29, 440
Psp6I CCWGG 1 cut(s) 449
PspEI GGTNACC 1 cut(s) 395
PspGI CCWGG 1 cut(s) 449
PspPI GGNCC 1 cut(s) 73
PstNI CAGNNNCTG 1 cut(s) 112
RsaI GTAC 1 cut(s) 312
RsaNI GTAC 1 cut(s) 311
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 1 cut(s) 300
Sau96I GGNCC 1 cut(s) 73
ScrFI CCNGG 1 cut(s) 451
SetI ASST 6 cut(s) 16, 111, 207, 216, 229, 402
SfaNI GCATC 1 cut(s) 242
Sfr274I CTCGAG 1 cut(s) 50
SinI GGWCC 1 cut(s) 73
SlaI CTCGAG 1 cut(s) 50
SmlI CTYRAG 2 cut(s) 50, 147
SmoI CTYRAG 2 cut(s) 50, 147
Sse9I AATT 2 cut(s) 168, 192
SspMI CTAG 1 cut(s) 344
StyD4I CCNGG 1 cut(s) 449
StyI CCWWGG 1 cut(s) 237
TaaI ACNGT 1 cut(s) 182
TaqI TCGA 1 cut(s) 51
TasI AATT 2 cut(s) 168, 192
TatI WGTACW 1 cut(s) 310
TfiI GAWTC 2 cut(s) 29, 440
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TseFI GTSAC 1 cut(s) 122
Tsp45I GTSAC 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 17, 468
TspGWI ACGGA 1 cut(s) 141
VpaK11BI GGWCC 1 cut(s) 73
XapI RAATTY 1 cut(s) 168
XhoI CTCGAG 1 cut(s) 50
XmnI GAANNNNTTC 1 cut(s) 171
XspI CTAG 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.