Rh5DG131300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0000731
Physical Location & Seq
Forward (+)
12833662 .. 12833979
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG131300.1

Sequence Viewer

Length: 318 bp
ATGATTGGTTGCCAATGTGTAGATTTAATGGTAATATTGGAGTTGTGGGATTTGGCATTTAGACATATGCAAAGAGGTAGAACTGCAAGTCTAAAAGGGCAAATCGAAAACCTCAAGGTCCGTGGATTCTGTGTGGAGAGACGGAAGGATGGCAACCAGCCTAGAGGACATCGCACTATAGTCATGGATCCGCCTTTTTATAAAAGGCTGAAAATTATGGGGGATCAAGAACAGATTTTGAGTATACTGACGGAGCTTTATATCATATCCGAAGTGAAGTCTACTCTTGGCACAAAGGGTTTGATTTCTTGCTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

12.05

Weight (kDa)

9.26

Isoelectric Point (pI)

35.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 201
AccI GTMKAC 2 cut(s) 244, 281
AciI CCGC 1 cut(s) 191
AclWI GGATC 3 cut(s) 182, 195, 231
AluBI AGCT 1 cut(s) 256
AluI AGCT 1 cut(s) 256
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 3 cut(s) 182, 195, 231
AspS9I GGNCC 1 cut(s) 118
AvaII GGWCC 1 cut(s) 118
BamHI GGATCC 1 cut(s) 187
BccI CCATC 1 cut(s) 143
BcoDI GTCTC 1 cut(s) 133
BfaI CTAG 1 cut(s) 162
BfmI CTRYAG 1 cut(s) 177
Bme18I GGWCC 1 cut(s) 118
BmgT120I GGNCC 1 cut(s) 118
BmiI GGNNCC 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 121
BseDI CCNNGG 1 cut(s) 121
BseGI GGATG 1 cut(s) 154
BsmAI GTCTC 1 cut(s) 133
BsmBI CGTCTC 1 cut(s) 133
Bsp143I GATC 2 cut(s) 187, 223
BspACI CCGC 1 cut(s) 191
BspLI GGNNCC 1 cut(s) 189
BspPI GGATC 3 cut(s) 182, 195, 231
BssECI CCNNGG 1 cut(s) 121
BssMI GATC 2 cut(s) 187, 223
BssNAI GTATAC 1 cut(s) 245
Bst1107I GTATAC 1 cut(s) 245
BstDSI CCRYGG 1 cut(s) 121
BstF5I GGATG 1 cut(s) 154
BstKTI GATC 2 cut(s) 190, 226
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 2 cut(s) 187, 223
BstSFI CTRYAG 1 cut(s) 177
BstX2I RGATCY 1 cut(s) 187
BstYI RGATCY 1 cut(s) 187
BstZ17I GTATAC 1 cut(s) 245
BtgI CCRYGG 1 cut(s) 121
BtgZI GCGATG 1 cut(s) 155
BtsCI GGATG 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 118
CspCI CAANNNNNGTGG 2 cut(s) 103, 138
CviAII CATG 1 cut(s) 184
CviJI RGCY 3 cut(s) 160, 208, 256
CviKI_1 RGCY 3 cut(s) 160, 208, 256
DpnI GATC 2 cut(s) 189, 225
DpnII GATC 2 cut(s) 187, 223
EciI GGCGGA 1 cut(s) 180
Eco47I GGWCC 1 cut(s) 118
Esp3I CGTCTC 1 cut(s) 133
FaeI CATG 1 cut(s) 187
FaiI YATR 9 cut(s) 66, 68, 179, 185, 201, 218, 245, 261, 266
FatI CATG 1 cut(s) 183
FauNDI CATATG 1 cut(s) 66
FblI GTMKAC 2 cut(s) 244, 281
FokI GGATG 1 cut(s) 161
FspBI CTAG 1 cut(s) 162
Hin1II CATG 1 cut(s) 187
HinfI GANTC 1 cut(s) 126
Hpy166II GTNNAC 2 cut(s) 245, 282
Hpy188I TCNGA 1 cut(s) 271
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 2 cut(s) 245, 282
HpyAV CCTTC 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 70, 86
Hsp92II CATG 1 cut(s) 187
Kzo9I GATC 2 cut(s) 187, 223
LmnI GCTCC 1 cut(s) 253
LpnPI CCDG 1 cut(s) 170
MaeI CTAG 1 cut(s) 162
MalI GATC 2 cut(s) 189, 225
MboI GATC 2 cut(s) 187, 223
MflI RGATCY 1 cut(s) 187
MluCI AATT 1 cut(s) 213
MnlI CCTC 3 cut(s) 68, 122, 158
MseI TTAA 1 cut(s) 26
NdeI CATATG 1 cut(s) 66
NdeII GATC 2 cut(s) 187, 223
NlaIII CATG 1 cut(s) 187
NlaIV GGNNCC 1 cut(s) 189
PfeI GAWTC 1 cut(s) 126
PsiI TTATAA 1 cut(s) 201
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 118
PsuI RGATCY 1 cut(s) 187
SaqAI TTAA 1 cut(s) 26
Sau3AI GATC 2 cut(s) 187, 223
Sau96I GGNCC 1 cut(s) 118
SetI ASST 4 cut(s) 79, 114, 120, 258
SfcI CTRYAG 1 cut(s) 177
SgeI CNNG 8 cut(s) 99, 127, 134, 169, 174, 196, 239, 299
SinI GGWCC 1 cut(s) 118
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
Sse9I AATT 1 cut(s) 213
SsiI CCGC 1 cut(s) 191
SspI AATATT 1 cut(s) 36
SspMI CTAG 1 cut(s) 162
TaqI TCGA 1 cut(s) 105
TasI AATT 1 cut(s) 213
TfiI GAWTC 1 cut(s) 126
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TspGWI ACGGA 3 cut(s) 110, 157, 266
VpaK11BI GGWCC 1 cut(s) 118
XmiI GTMKAC 2 cut(s) 244, 281
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.