FvH4_3g20961

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Forward (+)
13987942 .. 13988457
516 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g20961.t1

Sequence Viewer

Length: 267 bp
ATGAGGGACAAATGCTCCAAGCGGAAGGATTTGACTGTTGGTACTGAGGCTGCGGCTGCTGAAAGGATGGTTGTTGATAATGCTCGTAGAAACTTTGCGAAATTGTTTGTTGGTAAGAATGTTGTTGTTGCTGCTGCTGCATACGAGGCACATCTGGTGAGGATGATCCAATTTGAGTTTGAAGATGAGGGACCTGATCAGATTCTCATCGTGGATGAAAAATGCAAGGCTTTCATCATCGATTATCTCCACAGGTTGAGTAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.04

Weight (kDa)

7.79

Isoelectric Point (pI)

13.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 22, 53
AclWI GGATC 1 cut(s) 160
AfaI GTAC 1 cut(s) 43
AgsI TTSAA 1 cut(s) 182
AlwI GGATC 1 cut(s) 160
ApeKI GCWGC 5 cut(s) 50, 56, 131, 134, 137
AspS9I GGNCC 1 cut(s) 191
AsuHPI GGTGA 1 cut(s) 169
AvaII GGWCC 1 cut(s) 191
BbvI GCAGC 5 cut(s) 37, 43, 118, 121, 124
BccI CCATC 1 cut(s) 61
BclI TGATCA 1 cut(s) 196
BisI GCNGC 6 cut(s) 51, 54, 57, 132, 135, 138
BlsI GCNGC 6 cut(s) 52, 55, 58, 133, 136, 139
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 191
BmiI GGNNCC 1 cut(s) 192
Bsa29I ATCGAT 1 cut(s) 240
BsaBI GATNNNNATC 1 cut(s) 206
BsaXI ACNNNNNCTCC 1 cut(s) 29
Bse8I GATNNNNATC 1 cut(s) 206
BseCI ATCGAT 1 cut(s) 240
BseGI GGATG 3 cut(s) 72, 168, 220
BseJI GATNNNNATC 1 cut(s) 206
BseMII CTCAG 1 cut(s) 36
BseXI GCAGC 5 cut(s) 37, 43, 118, 121, 124
BshVI ATCGAT 1 cut(s) 240
BslFI GGGAC 2 cut(s) 20, 204
BsmFI GGGAC 2 cut(s) 20, 204
Bsp143I GATC 2 cut(s) 165, 196
BspACI CCGC 2 cut(s) 22, 53
BspCNI CTCAG 1 cut(s) 37
BspDI ATCGAT 1 cut(s) 240
BspLI GGNNCC 1 cut(s) 192
BspPI GGATC 1 cut(s) 160
BssMI GATC 2 cut(s) 165, 196
Bst4CI ACNGT 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 45
BstF5I GGATG 3 cut(s) 72, 168, 220
BstKTI GATC 2 cut(s) 168, 199
BstMBI GATC 2 cut(s) 165, 196
BstMWI GCNNNNNNNGC 3 cut(s) 56, 137, 146
BstV1I GCAGC 5 cut(s) 37, 43, 118, 121, 124
Bsu15I ATCGAT 1 cut(s) 240
BsuTUI ATCGAT 1 cut(s) 240
BtsCI GGATG 3 cut(s) 72, 168, 220
Cfr13I GGNCC 1 cut(s) 191
ClaI ATCGAT 1 cut(s) 240
Csp6I GTAC 1 cut(s) 42
CviJI RGCY 3 cut(s) 50, 56, 230
CviKI_1 RGCY 3 cut(s) 50, 56, 230
CviQI GTAC 1 cut(s) 42
DdeI CTNAG 1 cut(s) 45
DpnI GATC 2 cut(s) 167, 198
DpnII GATC 2 cut(s) 165, 196
Eco47I GGWCC 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 191
FaiI YATR 1 cut(s) 142
FaqI GGGAC 2 cut(s) 20, 204
FbaI TGATCA 1 cut(s) 196
Fnu4HI GCNGC 6 cut(s) 51, 54, 57, 132, 135, 138
FokI GGATG 3 cut(s) 79, 175, 227
Fsp4HI GCNGC 6 cut(s) 51, 54, 57, 132, 135, 138
GluI GCNGC 6 cut(s) 51, 54, 57, 132, 135, 138
HinfI GANTC 1 cut(s) 202
HphI GGTGA 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 201
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4V TGCA 2 cut(s) 140, 225
HpyF10VI GCNNNNNNNGC 3 cut(s) 56, 137, 146
HpyF3I CTNAG 1 cut(s) 45
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 2 cut(s) 165, 196
LmnI GCTCC 1 cut(s) 20
LpnPI CCDG 3 cut(s) 140, 207, 238
Lsp1109I GCAGC 5 cut(s) 37, 43, 118, 121, 124
MalI GATC 2 cut(s) 167, 198
MboI GATC 2 cut(s) 165, 196
MboII GAAGA 1 cut(s) 194
MluCI AATT 2 cut(s) 101, 170
MnlI CCTC 4 cut(s) 40, 139, 153, 181
MwoI GCNNNNNNNGC 3 cut(s) 56, 137, 146
NdeII GATC 2 cut(s) 165, 196
NlaIV GGNNCC 1 cut(s) 192
PfeI GAWTC 1 cut(s) 202
PkrI GCNGC 6 cut(s) 52, 55, 58, 133, 136, 139
PpuMI RGGWCCY 1 cut(s) 191
Psp5II RGGWCCY 1 cut(s) 191
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 1 cut(s) 191
PspPPI RGGWCCY 1 cut(s) 191
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SatI GCNGC 6 cut(s) 51, 54, 57, 132, 135, 138
Sau3AI GATC 2 cut(s) 165, 196
Sau96I GGNCC 1 cut(s) 191
SetI ASST 3 cut(s) 196, 257, 266
SgeI CNNG 7 cut(s) 31, 96, 157, 167, 206, 223, 238
SinI GGWCC 1 cut(s) 191
Sse9I AATT 2 cut(s) 101, 170
SsiI CCGC 2 cut(s) 22, 53
TaaI ACNGT 1 cut(s) 37
TaqI TCGA 1 cut(s) 240
TasI AATT 2 cut(s) 101, 170
TauI GCSGC 1 cut(s) 56
TfiI GAWTC 1 cut(s) 202
TseI GCWGC 5 cut(s) 50, 56, 131, 134, 137
TspDTI ATGAA 2 cut(s) 223, 231
VpaK11BI GGWCC 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.