Rh5AG245000

Phosphoenolpyruvate carboxylase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
30055321 .. 30081693
26373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG245000.1

Sequence Viewer

Length: 231 bp
ATGCCTAACGAACATCACATTATCTCTAAAGCTTACGAAGACCCTGTAATTTACTCTGTATTAAGCAGAGACAAATCGAAACCTGAGCGCAATGTATATATTAAATTCAGATTATATCACAAATTCAAAGTGGAGCTTTTGCAAAAAGATGCACGACTTGCCGTTAGTGGACAGATAGGAAAGCCATGTCCTGGTGGAACGCAAGTTCATGGTCTGCAAGTTCATTGGTGA

Protein Analysis

76

Amino Acids

8.78

Weight (kDa)

9.56

Isoelectric Point (pI)

32.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 191
AcsI RAATTY 2 cut(s) 104, 122
AfiI CCNNNNNNNGG 1 cut(s) 191
AgsI TTSAA 1 cut(s) 127
AjnI CCWGG 1 cut(s) 190
AloI GAACNNNNNNTCC 2 cut(s) 189, 221
AluBI AGCT 2 cut(s) 32, 136
AluI AGCT 2 cut(s) 32, 136
Alw26I GTCTC 1 cut(s) 63
ApoI RAATTY 2 cut(s) 104, 122
AspLEI GCGC 1 cut(s) 90
BbsI GAAGAC 1 cut(s) 45
BceAI ACGGC 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 192
BmsI GCATC 1 cut(s) 139
BpiI GAAGAC 1 cut(s) 45
Bpu10I CCTNAGC 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 191
Bse3DI GCAATG 1 cut(s) 97
BseBI CCWGG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 191
BseMI GCAATG 1 cut(s) 97
BseMII CTCAG 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 191
BsmAI GTCTC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 76
BsrDI GCAATG 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 192
BstAPI GCANNNNNTGC 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 84
BstHHI GCGC 1 cut(s) 90
BstMAI GTCTC 1 cut(s) 63
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstNI CCWGG 1 cut(s) 192
BstSCI CCNGG 1 cut(s) 190
BstV2I GAAGAC 1 cut(s) 45
CfoI GCGC 1 cut(s) 90
CviAII CATG 2 cut(s) 186, 209
CviJI RGCY 3 cut(s) 32, 136, 184
CviKI_1 RGCY 3 cut(s) 32, 136, 184
DdeI CTNAG 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 190
FaeI CATG 2 cut(s) 189, 212
FaiI YATR 5 cut(s) 97, 99, 115, 187, 210
FalI AAGNNNNNCTT 2 cut(s) 120, 152
FatI CATG 2 cut(s) 185, 208
GlaI GCGC 1 cut(s) 89
HhaI GCGC 1 cut(s) 90
Hin1II CATG 2 cut(s) 189, 212
Hin6I GCGC 1 cut(s) 88
HinP1I GCGC 1 cut(s) 88
HindIII AAGCTT 1 cut(s) 30
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 110
Hpy8I GTNNAC 1 cut(s) 170
HpyCH4V TGCA 3 cut(s) 142, 152, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 2 cut(s) 189, 212
HspAI GCGC 1 cut(s) 88
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 4 cut(s) 57, 96, 177, 204
LweI GCATC 1 cut(s) 139
MboII GAAGA 1 cut(s) 50
MluCI AATT 3 cut(s) 48, 104, 122
MseI TTAA 2 cut(s) 62, 102
MspR9I CCNGG 1 cut(s) 192
MvaI CCWGG 1 cut(s) 192
MwoI GCNNNNNNNGC 1 cut(s) 158
NlaIII CATG 2 cut(s) 189, 212
PflMI CCANNNNNTGG 1 cut(s) 191
Psp6I CCWGG 1 cut(s) 190
PspGI CCWGG 1 cut(s) 190
SaqAI TTAA 2 cut(s) 62, 102
ScrFI CCNGG 1 cut(s) 192
SetI ASST 3 cut(s) 34, 85, 138
SfaNI GCATC 1 cut(s) 139
SgeI CNNG 9 cut(s) 56, 95, 165, 170, 198, 203, 204, 215, 221
Sse9I AATT 3 cut(s) 48, 104, 122
StyD4I CCNGG 1 cut(s) 190
TaqI TCGA 1 cut(s) 77
TasI AATT 3 cut(s) 48, 104, 122
Tru1I TTAA 2 cut(s) 62, 102
Tru9I TTAA 2 cut(s) 62, 102
TspDTI ATGAA 2 cut(s) 197, 212
Van91I CCANNNNNTGG 1 cut(s) 191
XapI RAATTY 2 cut(s) 104, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.