FvH4_5g26720

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0000753
Physical Location & Seq
Forward (+)
18146406 .. 18147017
612 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g26720.t1

Sequence Viewer

Length: 306 bp
ATGCATGTCAACCGCCTTTTCTTTGTTGATTCAGAACCAACCAGAACCGATTGTGGTGCTGGATATGTTAACCAGCCACCTTATCAGCAACTTCAGACACAGGGGAAGGAGCTGGACATTCTTGAAAAGCTCTACTACCACCCTGGCTTACAATCAAAAGAAGAAAATGGGTTGCTCATGTACAATTCTTATAAAAAGATAACTATGCAACGAAAGGGAATAAGTACTTCGATAATGGGTGTTGCTGCTGAAAGGGAGGAGGCTGCCTCGCTATCGTTGCCATGGGCTGGAAGGAGAGAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.52

Weight (kDa)

6.73

Isoelectric Point (pI)

45.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 192
AccB7I CCANNNNNTGG 1 cut(s) 287
AciI CCGC 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 77
AfaI GTAC 2 cut(s) 182, 226
AfiI CCNNNNNNNGG 1 cut(s) 287
AgsI TTSAA 1 cut(s) 125
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 2 cut(s) 112, 130
AluI AGCT 2 cut(s) 112, 130
ApeKI GCWGC 2 cut(s) 245, 263
BbvI GCAGC 2 cut(s) 232, 250
BcgI CGANNNNNNTGC 2 cut(s) 38, 72
BciT130I CCWGG 1 cut(s) 144
BisI GCNGC 2 cut(s) 246, 264
BlsI GCNGC 2 cut(s) 247, 265
BmcAI AGTACT 1 cut(s) 226
Bme1390I CCNGG 1 cut(s) 144
BmrFI CCNGG 1 cut(s) 144
BplI GAGNNNNNCTC 2 cut(s) 251, 283
BsaJI CCNNGG 2 cut(s) 142, 281
Bsc4I CCNNNNNNNGG 1 cut(s) 287
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 2 cut(s) 142, 281
BseLI CCNNNNNNNGG 1 cut(s) 287
BseRI GAGGAG 1 cut(s) 272
BseXI GCAGC 2 cut(s) 232, 250
BslI CCNNNNNNNGG 1 cut(s) 287
Bsp1407I TGTACA 1 cut(s) 180
Bsp19I CCATGG 1 cut(s) 281
BspACI CCGC 1 cut(s) 13
BsrGI TGTACA 1 cut(s) 180
BssECI CCNNGG 2 cut(s) 142, 281
BssT1I CCWWGG 1 cut(s) 281
Bst2UI CCWGG 1 cut(s) 144
BstAUI TGTACA 1 cut(s) 180
BstDSI CCRYGG 1 cut(s) 281
BstMWI GCNNNNNNNGC 1 cut(s) 277
BstNI CCWGG 1 cut(s) 144
BstNSI RCATGY 1 cut(s) 8
BstSCI CCNGG 1 cut(s) 142
BstV1I GCAGC 2 cut(s) 232, 250
BtgI CCRYGG 1 cut(s) 281
Csp6I GTAC 2 cut(s) 181, 225
CviAII CATG 3 cut(s) 5, 178, 282
CviJI RGCY 6 cut(s) 76, 112, 130, 147, 263, 287
CviKI_1 RGCY 6 cut(s) 76, 112, 130, 147, 263, 287
CviQI GTAC 2 cut(s) 181, 225
Eco130I CCWWGG 1 cut(s) 281
Eco57I CTGAAG 1 cut(s) 77
EcoRII CCWGG 1 cut(s) 142
EcoT14I CCWWGG 1 cut(s) 281
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 281
FaeI CATG 3 cut(s) 8, 181, 285
FaiI YATR 6 cut(s) 6, 66, 179, 192, 206, 283
FatI CATG 3 cut(s) 4, 177, 281
Fnu4HI GCNGC 2 cut(s) 246, 264
Fsp4HI GCNGC 2 cut(s) 246, 264
GluI GCNGC 2 cut(s) 246, 264
Hin1II CATG 3 cut(s) 8, 181, 285
HincII GTYRAC 2 cut(s) 10, 70
HindII GTYRAC 2 cut(s) 10, 70
HinfI GANTC 1 cut(s) 29
HpaI GTTAAC 1 cut(s) 70
Hpy166II GTNNAC 2 cut(s) 10, 70
Hpy188I TCNGA 2 cut(s) 34, 96
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 2 cut(s) 10, 70
HpyAV CCTTC 2 cut(s) 100, 285
HpyCH4V TGCA 2 cut(s) 4, 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 277
Hsp92II CATG 3 cut(s) 8, 181, 285
KspAI GTTAAC 1 cut(s) 70
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 8 cut(s) 45, 55, 86, 86, 98, 129, 156, 273
Lsp1109I GCAGC 2 cut(s) 232, 250
MboII GAAGA 1 cut(s) 173
MluCI AATT 2 cut(s) 184, 301
MnlI CCTC 3 cut(s) 250, 253, 277
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 69
MspR9I CCNGG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 144
MwoI GCNNNNNNNGC 1 cut(s) 277
NcoI CCATGG 1 cut(s) 281
NlaIII CATG 3 cut(s) 8, 181, 285
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 8
PfeI GAWTC 1 cut(s) 29
PflMI CCANNNNNTGG 1 cut(s) 287
PkrI GCNGC 2 cut(s) 247, 265
PsiI TTATAA 1 cut(s) 192
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
RsaI GTAC 2 cut(s) 182, 226
RsaNI GTAC 2 cut(s) 181, 225
SaqAI TTAA 1 cut(s) 69
SatI GCNGC 2 cut(s) 246, 264
ScaI AGTACT 1 cut(s) 226
ScrFI CCNGG 1 cut(s) 144
SetI ASST 3 cut(s) 82, 114, 132
Sse9I AATT 2 cut(s) 184, 301
SsiI CCGC 1 cut(s) 13
StyD4I CCNGG 1 cut(s) 142
StyI CCWWGG 1 cut(s) 281
TaqI TCGA 1 cut(s) 230
TasI AATT 2 cut(s) 184, 301
TatI WGTACW 2 cut(s) 180, 224
TfiI GAWTC 1 cut(s) 29
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TseI GCWGC 2 cut(s) 245, 263
Van91I CCANNNNNTGG 1 cut(s) 287
XceI RCATGY 1 cut(s) 8
ZrmI AGTACT 1 cut(s) 226
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.