Rroxscaffold_2G00105360

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000753
Physical Location & Seq
Forward (+)
28784327 .. 28796163
11837 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00105360.1

Sequence Viewer

Length: 285 bp
ATGGCTCAAAATTTGGCGGAGATTGGAAGAAAACCAGAAGTACATAAATATACAGAACCTGATCAACGGAGAGCCAATGTAGAAGTGGTATATAACAACTTCAAGGGGAACTACATCACGGATGCTAGGACATTATTCAAGTTCTATCGGCATTACATCATTCACTATAATGACTATTTGTCAGAGAGAAAGATAGAATCCAGTAAACTTCTCAGACAAGCAACATACACACAGAGATTGGCATTTATCTGGACTAGCAGAAATCTTGCACTTCGACAACGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

11.43

Weight (kDa)

9.99

Isoelectric Point (pI)

49.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 17
AclI AACGTT 1 cut(s) 280
AcsI RAATTY 1 cut(s) 10
AfaI GTAC 1 cut(s) 42
AgsI TTSAA 2 cut(s) 103, 139
AhdI GACNNNNNGTC 1 cut(s) 178
AlwNI CAGNNNCTG 1 cut(s) 59
ApoI RAATTY 1 cut(s) 10
BclI TGATCA 1 cut(s) 61
BfaI CTAG 2 cut(s) 126, 255
BmeRI GACNNNNNGTC 1 cut(s) 178
BmsI GCATC 1 cut(s) 112
Bse1I ACTGG 1 cut(s) 201
BseGI GGATG 1 cut(s) 127
BseMII CTCAG 1 cut(s) 226
BseNI ACTGG 1 cut(s) 201
Bsp143I GATC 1 cut(s) 61
BspACI CCGC 1 cut(s) 17
BspCNI CTCAG 1 cut(s) 225
BsrI ACTGG 1 cut(s) 201
BssMI GATC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 212
BstF5I GGATG 1 cut(s) 127
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BtsCI GGATG 1 cut(s) 127
CaiI CAGNNNCTG 1 cut(s) 59
Csp6I GTAC 1 cut(s) 41
CviJI RGCY 2 cut(s) 5, 74
CviKI_1 RGCY 2 cut(s) 5, 74
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 1 cut(s) 212
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
DriI GACNNNNNGTC 1 cut(s) 178
Eam1105I GACNNNNNGTC 1 cut(s) 178
EciI GGCGGA 1 cut(s) 32
FaiI YATR 6 cut(s) 45, 51, 91, 93, 168, 226
FbaI TGATCA 1 cut(s) 61
FokI GGATG 1 cut(s) 134
FspBI CTAG 2 cut(s) 126, 255
HinfI GANTC 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 206
Hpy188I TCNGA 2 cut(s) 184, 215
Hpy188III TCNNGA 1 cut(s) 250
Hpy8I GTNNAC 1 cut(s) 206
HpyCH4IV ACGT 1 cut(s) 280
HpyCH4V TGCA 1 cut(s) 269
HpyF3I CTNAG 1 cut(s) 212
HpySE526I ACGT 1 cut(s) 280
Ksp22I TGATCA 1 cut(s) 61
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 4 cut(s) 48, 72, 214, 235
LweI GCATC 1 cut(s) 112
MaeI CTAG 2 cut(s) 126, 255
MaeII ACGT 1 cut(s) 280
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 39
MluCI AATT 1 cut(s) 10
MslI CAYNNNNRTG 1 cut(s) 168
NdeII GATC 1 cut(s) 61
PfeI GAWTC 1 cut(s) 197
Psp1406I AACGTT 1 cut(s) 280
PstNI CAGNNNCTG 1 cut(s) 59
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
RseI CAYNNNNRTG 1 cut(s) 168
Sau3AI GATC 1 cut(s) 61
SetI ASST 2 cut(s) 61, 283
SfaNI GCATC 1 cut(s) 112
SmiMI CAYNNNNRTG 1 cut(s) 168
Sse9I AATT 1 cut(s) 10
SsiI CCGC 1 cut(s) 17
SspMI CTAG 2 cut(s) 126, 255
TaiI ACGT 1 cut(s) 283
TaqI TCGA 1 cut(s) 274
TasI AATT 1 cut(s) 10
TatI WGTACW 1 cut(s) 40
TfiI GAWTC 1 cut(s) 197
TspGWI ACGGA 2 cut(s) 82, 134
XapI RAATTY 1 cut(s) 10
XcmI CCANNNNNNNNNTGG 1 cut(s) 82
XspI CTAG 2 cut(s) 126, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.