FvH4_5g38670

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
28589306 .. 28591155
1850 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g38670.t5

Sequence Viewer

Length: 246 bp
ATGGCGAATTCGTTGTTTATTCCAAACAACTACTTGGCCATACCTCCTCCTCGACTGTCCTCGAAATCCATTGCTCCTCCTCCCCAAGTTCTTTTTGGGTTTTCAGTAGCCAAATCTTCCCCTATAGTCCTACACAGCAGCAGCAGCAGCAGCAGAAGCCGTGCCTCGTCTTTCAAATCTCATCTCGCTGCTGCTCGAGGCTATGTTCCCCCAGCTCTCAAGTCAAGATATGAAACCTTCTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

8.66

Weight (kDa)

11.08

Isoelectric Point (pI)

60.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 36
AcsI RAATTY 1 cut(s) 7
AgsI TTSAA 1 cut(s) 175
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
Ama87I CYCGRG 1 cut(s) 195
AoxI GGCC 1 cut(s) 36
ApeKI GCWGC 7 cut(s) 138, 141, 144, 147, 150, 188, 191
ApoI RAATTY 1 cut(s) 7
AvaI CYCGRG 1 cut(s) 195
BalI TGGCCA 1 cut(s) 38
BbvI GCAGC 7 cut(s) 150, 153, 156, 159, 162, 175, 178
BceAI ACGGC 1 cut(s) 144
BfmI CTRYAG 1 cut(s) 123
BisI GCNGC 7 cut(s) 139, 142, 145, 148, 151, 189, 192
BlsI GCNGC 7 cut(s) 140, 143, 146, 149, 152, 190, 193
BmeT110I CYCGRG 1 cut(s) 195
BpuEI CTTGAG 1 cut(s) 203
Bse3DI GCAATG 1 cut(s) 69
BseMI GCAATG 1 cut(s) 69
BseRI GAGGAG 4 cut(s) 36, 39, 66, 69
BseXI GCAGC 7 cut(s) 150, 153, 156, 159, 162, 175, 178
BseYI CCCAGC 1 cut(s) 211
BshFI GGCC 1 cut(s) 38
BsiHKCI CYCGRG 1 cut(s) 195
BsnI GGCC 1 cut(s) 38
BsoBI CYCGRG 1 cut(s) 195
BspANI GGCC 1 cut(s) 38
BsrDI GCAATG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 57
BstMWI GCNNNNNNNGC 4 cut(s) 144, 147, 150, 156
BstSFI CTRYAG 1 cut(s) 123
BstV1I GCAGC 7 cut(s) 150, 153, 156, 159, 162, 175, 178
BsuRI GGCC 1 cut(s) 38
CviJI RGCY 5 cut(s) 38, 110, 159, 201, 215
CviKI_1 RGCY 5 cut(s) 38, 110, 159, 201, 215
EaeI YGGCCR 1 cut(s) 36
Eco88I CYCGRG 1 cut(s) 195
EcoRI GAATTC 1 cut(s) 7
FaiI YATR 5 cut(s) 41, 125, 204, 231, 244
Fnu4HI GCNGC 7 cut(s) 139, 142, 145, 148, 151, 189, 192
Fsp4HI GCNGC 7 cut(s) 139, 142, 145, 148, 151, 189, 192
GluI GCNGC 7 cut(s) 139, 142, 145, 148, 151, 189, 192
GsaI CCCAGC 1 cut(s) 215
HaeIII GGCC 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 225
HpyCH4III ACNGT 1 cut(s) 57
HpyF10VI GCNNNNNNNGC 4 cut(s) 144, 147, 150, 156
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 1 cut(s) 225
Lsp1109I GCAGC 7 cut(s) 150, 153, 156, 159, 162, 175, 178
MboII GAAGA 1 cut(s) 108
MlsI TGGCCA 1 cut(s) 38
MluCI AATT 1 cut(s) 7
MluNI TGGCCA 1 cut(s) 38
MnlI CCTC 8 cut(s) 54, 57, 60, 70, 87, 90, 175, 191
Mox20I TGGCCA 1 cut(s) 38
MscI TGGCCA 1 cut(s) 38
Msp20I TGGCCA 1 cut(s) 38
MwoI GCNNNNNNNGC 4 cut(s) 144, 147, 150, 156
PaeR7I CTCGAG 1 cut(s) 195
PkrI GCNGC 7 cut(s) 140, 143, 146, 149, 152, 190, 193
PspFI CCCAGC 1 cut(s) 211
PspXI VCTCGAGB 1 cut(s) 195
SatI GCNGC 7 cut(s) 139, 142, 145, 148, 151, 189, 192
SetI ASST 3 cut(s) 46, 217, 239
SfcI CTRYAG 1 cut(s) 123
Sfr274I CTCGAG 1 cut(s) 195
SlaI CTCGAG 1 cut(s) 195
SmlI CTYRAG 2 cut(s) 195, 218
SmoI CTYRAG 2 cut(s) 195, 218
Sse9I AATT 1 cut(s) 7
TaaI ACNGT 1 cut(s) 57
TaqI TCGA 3 cut(s) 52, 62, 196
TasI AATT 1 cut(s) 7
TseI GCWGC 7 cut(s) 138, 141, 144, 147, 150, 188, 191
TspDTI ATGAA 1 cut(s) 246
XapI RAATTY 1 cut(s) 7
XcmI CCANNNNNNNNNTGG 1 cut(s) 92
XhoI CTCGAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.