Rroxscaffold_3G00219680

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001161
Physical Location & Seq
Forward (+)
1775121 .. 1779884
4764 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00219680.1

Sequence Viewer

Length: 222 bp
ATGCTCAAGGAGAAGTTAATTGAGAGCCTTTTGCCCATGGTTGACAATTTTGAGAGAGCAAAAGTACAAATTAGACCTGAAACTGAAAATGAGAAGAAAATTGATACAAGTTACAGGGGCTTATACAAGCAATTTGTTGGGATTATGAGGAGTTTGCGTGTGGCATCTGTATCAACTATGGGAAAACCCTTTGATCCTTCGGTGCATGAAGCTATTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GrpE

Protein Analysis

73

Amino Acids

8.37

Weight (kDa)

9.1

Isoelectric Point (pI)

25.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GrpE PF01025 4 - 72 1.5e-12 GrpE
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 188
AfaI GTAC 1 cut(s) 66
AluBI AGCT 1 cut(s) 212
AluI AGCT 1 cut(s) 212
AlwI GGATC 1 cut(s) 188
BmsI GCATC 1 cut(s) 173
BsaJI CCNNGG 1 cut(s) 36
BsaXI ACNNNNNCTCC 2 cut(s) 142, 172
BseDI CCNNGG 1 cut(s) 36
BseRI GAGGAG 1 cut(s) 163
Bsp143I GATC 1 cut(s) 193
Bsp19I CCATGG 1 cut(s) 36
BspPI GGATC 1 cut(s) 188
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 1 cut(s) 193
BssT1I CCWWGG 1 cut(s) 36
BstDSI CCRYGG 1 cut(s) 36
BstKTI GATC 1 cut(s) 196
BstMBI GATC 1 cut(s) 193
BtgI CCRYGG 1 cut(s) 36
Csp6I GTAC 1 cut(s) 65
CviAII CATG 3 cut(s) 37, 206, 219
CviJI RGCY 3 cut(s) 27, 120, 212
CviKI_1 RGCY 3 cut(s) 27, 120, 212
CviQI GTAC 1 cut(s) 65
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
Eco130I CCWWGG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 3 cut(s) 40, 209, 222
FaiI YATR 6 cut(s) 38, 124, 146, 179, 207, 220
FatI CATG 3 cut(s) 36, 205, 218
Hin1II CATG 3 cut(s) 40, 209, 222
HincII GTYRAC 1 cut(s) 43
HindII GTYRAC 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 207
HpyCH4V TGCA 2 cut(s) 205, 218
Hsp92II CATG 3 cut(s) 40, 209, 222
Kzo9I GATC 1 cut(s) 193
LpnPI CCDG 2 cut(s) 90, 100
LweI GCATC 1 cut(s) 173
MaeIII GTNAC 1 cut(s) 110
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MboII GAAGA 1 cut(s) 106
MluCI AATT 5 cut(s) 18, 46, 69, 99, 131
MnlI CCTC 1 cut(s) 141
MseI TTAA 1 cut(s) 17
NcoI CCATGG 1 cut(s) 36
NdeII GATC 1 cut(s) 193
NlaIII CATG 3 cut(s) 40, 209, 222
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
SaqAI TTAA 1 cut(s) 17
Sau3AI GATC 1 cut(s) 193
SetI ASST 2 cut(s) 79, 214
SfaNI GCATC 1 cut(s) 173
SgeI CNNG 8 cut(s) 19, 49, 89, 120, 127, 139, 170, 218
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 5 cut(s) 18, 46, 69, 99, 131
StyI CCWWGG 1 cut(s) 36
TasI AATT 5 cut(s) 18, 46, 69, 99, 131
TatI WGTACW 1 cut(s) 64
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TspDTI ATGAA 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.