Rmu_sc0005071.1_g000018

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005071.1
Physical Location & Seq
Reverse (-)
77190 .. 78443
1254 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005071.1_g000018.1.cds

Sequence Viewer

Length: 300 bp
atggcgaactcgttgtttatctcaaacaactacttcgtcatacctcctccttgcgtttctgcttccttctcctcgaaacccatctcttcccccttagttttacatagccgcagcagcagcagcaggcgtgcctcgtttttcaaatctcatttttctgctcgaggctctgttcccccagtgaatgccaaagaggataatgtagattctagtggagcagttcaacaacatttgcccagtttgaggaccctccttgaagtttacaaggatgctattttcaatgaagatgaaaagactgtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.83

Weight (kDa)

8.93

Isoelectric Point (pI)

55.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 109
AfiI CCNNNNNNNGG 1 cut(s) 240
AgsI TTSAA 4 cut(s) 142, 221, 254, 277
Ama87I CYCGRG 1 cut(s) 159
ApeKI GCWGC 4 cut(s) 111, 114, 117, 120
AspS9I GGNCC 1 cut(s) 243
AvaI CYCGRG 1 cut(s) 159
AvaII GGWCC 1 cut(s) 243
BbvI GCAGC 4 cut(s) 123, 126, 129, 132
BccI CCATC 1 cut(s) 89
BfaI CTAG 1 cut(s) 207
BisI GCNGC 5 cut(s) 109, 112, 115, 118, 121
BlsI GCNGC 5 cut(s) 110, 113, 116, 119, 122
Bme18I GGWCC 1 cut(s) 243
BmeT110I CYCGRG 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 243
BmiI GGNNCC 1 cut(s) 245
BmrI ACTGGG 2 cut(s) 170, 228
BmsI GCATC 1 cut(s) 256
BmuI ACTGGG 2 cut(s) 170, 228
Bsc4I CCNNNNNNNGG 1 cut(s) 240
Bse1I ACTGG 2 cut(s) 176, 234
BseGI GGATG 1 cut(s) 271
BseLI CCNNNNNNNGG 1 cut(s) 240
BseNI ACTGG 2 cut(s) 176, 234
BseRI GAGGAG 2 cut(s) 36, 61
BseXI GCAGC 4 cut(s) 123, 126, 129, 132
BsiHKCI CYCGRG 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 240
BsmI GAATGC 1 cut(s) 187
BsoBI CYCGRG 1 cut(s) 159
BspACI CCGC 1 cut(s) 109
BspLI GGNNCC 1 cut(s) 245
BsrI ACTGG 2 cut(s) 176, 234
Bst4CI ACNGT 1 cut(s) 295
Bst6I CTCTTC 1 cut(s) 91
BstC8I GCNNGC 2 cut(s) 125, 129
BstDEI CTNAG 1 cut(s) 94
BstF5I GGATG 1 cut(s) 271
BstMWI GCNNNNNNNGC 3 cut(s) 114, 117, 120
BstV1I GCAGC 4 cut(s) 123, 126, 129, 132
BtsCI GGATG 1 cut(s) 271
BtsIMutI CAGTG 1 cut(s) 183
Cac8I GCNNGC 2 cut(s) 125, 129
Cfr13I GGNCC 1 cut(s) 243
CviJI RGCY 2 cut(s) 108, 165
CviKI_1 RGCY 2 cut(s) 108, 165
DdeI CTNAG 1 cut(s) 94
Eam1104I CTCTTC 1 cut(s) 91
EarI CTCTTC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 243
Eco88I CYCGRG 1 cut(s) 159
EcoO109I RGGNCCY 1 cut(s) 243
FaiI YATR 2 cut(s) 41, 105
Fnu4HI GCNGC 5 cut(s) 109, 112, 115, 118, 121
FokI GGATG 1 cut(s) 278
Fsp4HI GCNGC 5 cut(s) 109, 112, 115, 118, 121
FspBI CTAG 1 cut(s) 207
GluI GCNGC 5 cut(s) 109, 112, 115, 118, 121
HinfI GANTC 1 cut(s) 203
Hpy166II GTNNAC 1 cut(s) 259
Hpy8I GTNNAC 1 cut(s) 259
HpyAV CCTTC 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 295
HpyF10VI GCNNNNNNNGC 3 cut(s) 114, 117, 120
HpyF3I CTNAG 1 cut(s) 94
LmnI GCTCC 1 cut(s) 212
LpnPI CCDG 3 cut(s) 109, 189, 247
Lsp1109I GCAGC 4 cut(s) 123, 126, 129, 132
LweI GCATC 1 cut(s) 256
MaeI CTAG 1 cut(s) 207
MboII GAAGA 2 cut(s) 78, 293
MnlI CCTC 8 cut(s) 54, 57, 82, 142, 155, 184, 234, 257
Mva1269I GAATGC 1 cut(s) 187
MwoI GCNNNNNNNGC 3 cut(s) 114, 117, 120
NlaIV GGNNCC 1 cut(s) 245
PaeR7I CTCGAG 1 cut(s) 159
PctI GAATGC 1 cut(s) 187
PfeI GAWTC 1 cut(s) 203
PkrI GCNGC 5 cut(s) 110, 113, 116, 119, 122
PpuMI RGGWCCY 1 cut(s) 243
Psp5II RGGWCCY 1 cut(s) 243
PspN4I GGNNCC 1 cut(s) 245
PspPI GGNCC 1 cut(s) 243
PspPPI RGGWCCY 1 cut(s) 243
PspXI VCTCGAGB 1 cut(s) 159
SatI GCNGC 5 cut(s) 109, 112, 115, 118, 121
Sau96I GGNCC 1 cut(s) 243
SetI ASST 1 cut(s) 46
SfaNI GCATC 1 cut(s) 256
Sfr274I CTCGAG 1 cut(s) 159
SinI GGWCC 1 cut(s) 243
SlaI CTCGAG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
SsiI CCGC 1 cut(s) 109
SspMI CTAG 1 cut(s) 207
TaaI ACNGT 1 cut(s) 295
TaqI TCGA 2 cut(s) 74, 160
TauI GCSGC 1 cut(s) 111
TfiI GAWTC 1 cut(s) 203
TscAI CASTG 1 cut(s) 183
TseI GCWGC 4 cut(s) 111, 114, 117, 120
TspDTI ATGAA 2 cut(s) 294, 300
TspRI CASTG 1 cut(s) 183
VpaK11BI GGWCC 1 cut(s) 243
XhoI CTCGAG 1 cut(s) 159
XspI CTAG 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.