Rmu_sc0008477.1_g000007

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008477.1
OG0001161
Physical Location & Seq
Reverse (-)
23414 .. 25874
2461 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008477.1_g000007.1.cds

Sequence Viewer

Length: 426 bp
atggcaaattcgttgtttatcccaaacaactacttcgtcatacctcctcctcgcgtttctgcttccttctcctcaaaacccattgctcctcctcctcctcaacctcttctaggcttttcagtcaccaactcttcccccgtagttttacagagccgcagcagtagcaggcgtgcctcgtttttcaaatctcatcttgctgctcgaggctctgttcccccagtgcatgaagtgactgcacgagaagagtctgaagaattcccagaggggattgtcattcaagaaattcgccatggctttttacttggtggtcgacttctaagactagcaatggttaatgtctctatagggcctggcagtaagaaaacccctatggccactgaaaaatcatcagggtcacctgcaacagctgcttcggtagagaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GrpE

Protein Analysis

141

Amino Acids

14.99

Weight (kDa)

10.25

Isoelectric Point (pI)

67.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 406
Acc36I ACCTGC 1 cut(s) 406
AccI GTMKAC 1 cut(s) 310
AccII CGCG 1 cut(s) 54
AciI CCGC 1 cut(s) 154
AcoI YGGCCR 1 cut(s) 372
AcsI RAATTY 3 cut(s) 7, 254, 282
AcuI CTGAAG 1 cut(s) 270
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 2 cut(s) 184, 278
AjnI CCWGG 1 cut(s) 349
AluBI AGCT 1 cut(s) 407
AluI AGCT 1 cut(s) 407
Alw26I GTCTC 1 cut(s) 343
Ama87I CYCGRG 1 cut(s) 201
AoxI GGCC 2 cut(s) 347, 372
ApeKI GCWGC 3 cut(s) 156, 197, 407
ApoI RAATTY 3 cut(s) 7, 254, 282
AspS9I GGNCC 1 cut(s) 347
AsuHPI GGTGA 2 cut(s) 115, 387
AvaI CYCGRG 1 cut(s) 201
BalI TGGCCA 1 cut(s) 374
BauI CACGAG 1 cut(s) 237
BbvI GCAGC 3 cut(s) 168, 184, 394
BciT130I CCWGG 1 cut(s) 351
BcoDI GTCTC 1 cut(s) 343
BfaI CTAG 2 cut(s) 110, 323
BfmI CTRYAG 1 cut(s) 342
BfuAI ACCTGC 1 cut(s) 406
BisI GCNGC 4 cut(s) 154, 157, 198, 408
BlsI GCNGC 4 cut(s) 155, 158, 199, 409
Bme1390I CCNGG 1 cut(s) 351
BmeT110I CYCGRG 1 cut(s) 201
BmgT120I GGNCC 1 cut(s) 347
BmrFI CCNGG 1 cut(s) 351
BmrI ACTGGG 1 cut(s) 212
BmuI ACTGGG 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 289
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 218
Bse3DI GCAATG 2 cut(s) 81, 333
BseBI CCWGG 1 cut(s) 351
BseDI CCNNGG 1 cut(s) 289
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMI GCAATG 2 cut(s) 81, 333
BseNI ACTGG 1 cut(s) 218
BseRI GAGGAG 7 cut(s) 36, 39, 61, 78, 81, 84, 87
BseXI GCAGC 3 cut(s) 168, 184, 394
BsgI GTGCAG 1 cut(s) 219
Bsh1236I CGCG 1 cut(s) 54
BshFI GGCC 2 cut(s) 349, 374
BsiHKCI CYCGRG 1 cut(s) 201
BslI CCNNNNNNNGG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 343
BsnI GGCC 2 cut(s) 349, 374
BsoBI CYCGRG 1 cut(s) 201
Bsp19I CCATGG 1 cut(s) 289
BspACI CCGC 1 cut(s) 154
BspANI GGCC 2 cut(s) 349, 374
BspFNI CGCG 1 cut(s) 54
BspMI ACCTGC 1 cut(s) 406
BsrDI GCAATG 2 cut(s) 81, 333
BsrI ACTGG 1 cut(s) 218
BssECI CCNNGG 1 cut(s) 289
BssSI CACGAG 1 cut(s) 237
BssT1I CCWWGG 1 cut(s) 289
Bst2BI CACGAG 1 cut(s) 237
Bst2UI CCWGG 1 cut(s) 351
Bst6I CTCTTC 3 cut(s) 111, 136, 237
BstAPI GCANNNNNTGC 1 cut(s) 407
BstC8I GCNNGC 2 cut(s) 167, 171
BstDEI CTNAG 1 cut(s) 317
BstDSI CCRYGG 1 cut(s) 289
BstEII GGTNACC 1 cut(s) 393
BstENI CCTNNNNNAGG 1 cut(s) 108
BstFNI CGCG 1 cut(s) 54
BstMAI GTCTC 1 cut(s) 343
BstMWI GCNNNNNNNGC 2 cut(s) 162, 407
BstNI CCWGG 1 cut(s) 351
BstPI GGTNACC 1 cut(s) 393
BstSCI CCNGG 1 cut(s) 349
BstSFI CTRYAG 1 cut(s) 342
BstUI CGCG 1 cut(s) 54
BstV1I GCAGC 3 cut(s) 168, 184, 394
BsuRI GGCC 2 cut(s) 349, 374
BtgI CCRYGG 1 cut(s) 289
BtsIMutI CAGTG 2 cut(s) 225, 375
BveI ACCTGC 1 cut(s) 406
Cac8I GCNNGC 2 cut(s) 167, 171
Cfr13I GGNCC 1 cut(s) 347
CviAII CATG 2 cut(s) 224, 290
CviJI RGCY 7 cut(s) 114, 153, 207, 294, 349, 374, 407
CviKI_1 RGCY 7 cut(s) 114, 153, 207, 294, 349, 374, 407
DdeI CTNAG 1 cut(s) 317
EaeI YGGCCR 1 cut(s) 372
Eam1104I CTCTTC 3 cut(s) 111, 136, 237
EarI CTCTTC 3 cut(s) 111, 136, 237
Eco130I CCWWGG 1 cut(s) 289
Eco57I CTGAAG 1 cut(s) 270
Eco88I CYCGRG 1 cut(s) 201
Eco91I GGTNACC 1 cut(s) 393
EcoNI CCTNNNNNAGG 1 cut(s) 108
EcoO109I RGGNCCY 1 cut(s) 347
EcoO65I GGTNACC 1 cut(s) 393
EcoRI GAATTC 1 cut(s) 254
EcoRII CCWGG 1 cut(s) 349
EcoT14I CCWWGG 1 cut(s) 289
ErhI CCWWGG 1 cut(s) 289
FaeI CATG 2 cut(s) 227, 293
FaiI YATR 5 cut(s) 41, 225, 291, 344, 371
FatI CATG 2 cut(s) 223, 289
FblI GTMKAC 1 cut(s) 310
Fnu4HI GCNGC 4 cut(s) 154, 157, 198, 408
Fsp4HI GCNGC 4 cut(s) 154, 157, 198, 408
FspBI CTAG 2 cut(s) 110, 323
GluI GCNGC 4 cut(s) 154, 157, 198, 408
HaeIII GGCC 2 cut(s) 349, 374
Hin1II CATG 2 cut(s) 227, 293
HincII GTYRAC 1 cut(s) 311
HindII GTYRAC 1 cut(s) 311
HinfI GANTC 1 cut(s) 245
HphI GGTGA 2 cut(s) 115, 387
Hpy166II GTNNAC 1 cut(s) 311
Hpy188I TCNGA 1 cut(s) 250
Hpy188III TCNNGA 1 cut(s) 278
Hpy8I GTNNAC 1 cut(s) 311
HpyAV CCTTC 1 cut(s) 76
HpyCH4V TGCA 3 cut(s) 223, 236, 401
HpyF10VI GCNNNNNNNGC 2 cut(s) 162, 407
HpyF3I CTNAG 1 cut(s) 317
Hsp92II CATG 2 cut(s) 227, 293
LmnI GCTCC 1 cut(s) 91
LpnPI CCDG 7 cut(s) 151, 231, 273, 336, 363, 375, 411
Lsp1109I GCAGC 3 cut(s) 168, 184, 394
MaeI CTAG 2 cut(s) 110, 323
MaeIII GTNAC 3 cut(s) 121, 229, 393
MboII GAAGA 4 cut(s) 98, 123, 254, 263
MlsI TGGCCA 1 cut(s) 374
MluCI AATT 4 cut(s) 7, 254, 282, 421
MluNI TGGCCA 1 cut(s) 374
MlyI GAGTC 1 cut(s) 254
Mox20I TGGCCA 1 cut(s) 374
MscI TGGCCA 1 cut(s) 374
MseI TTAA 1 cut(s) 333
Msp20I TGGCCA 1 cut(s) 374
MspA1I CMGCKG 1 cut(s) 407
MspR9I CCNGG 1 cut(s) 351
MvaI CCWGG 1 cut(s) 351
MvnI CGCG 1 cut(s) 54
MwoI GCNNNNNNNGC 2 cut(s) 162, 407
NcoI CCATGG 1 cut(s) 289
NlaIII CATG 2 cut(s) 227, 293
NmuCI GTSAC 3 cut(s) 121, 229, 393
PaeR7I CTCGAG 1 cut(s) 201
PaqCI CACCTGC 1 cut(s) 406
PkrI GCNGC 4 cut(s) 155, 158, 199, 409
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 349
PspEI GGTNACC 1 cut(s) 393
PspGI CCWGG 1 cut(s) 349
PspPI GGNCC 1 cut(s) 347
PspXI VCTCGAGB 1 cut(s) 201
PvuII CAGCTG 1 cut(s) 407
SalI GTCGAC 1 cut(s) 309
SaqAI TTAA 1 cut(s) 333
SatI GCNGC 4 cut(s) 154, 157, 198, 408
Sau96I GGNCC 1 cut(s) 347
SchI GAGTC 1 cut(s) 254
ScrFI CCNGG 1 cut(s) 351
SetI ASST 4 cut(s) 46, 106, 400, 409
SfcI CTRYAG 1 cut(s) 342
Sfr274I CTCGAG 1 cut(s) 201
SlaI CTCGAG 1 cut(s) 201
SmlI CTYRAG 1 cut(s) 201
SmoI CTYRAG 1 cut(s) 201
Sse9I AATT 4 cut(s) 7, 254, 282, 421
SsiI CCGC 1 cut(s) 154
SspMI CTAG 2 cut(s) 110, 323
StyD4I CCNGG 1 cut(s) 349
StyI CCWWGG 1 cut(s) 289
TaqI TCGA 2 cut(s) 202, 310
TasI AATT 4 cut(s) 7, 254, 282, 421
TauI GCSGC 1 cut(s) 156
Tru1I TTAA 1 cut(s) 333
Tru9I TTAA 1 cut(s) 333
TscAI CASTG 2 cut(s) 225, 382
TseFI GTSAC 3 cut(s) 121, 229, 393
TseI GCWGC 3 cut(s) 156, 197, 407
Tsp45I GTSAC 3 cut(s) 121, 229, 393
TspDTI ATGAA 1 cut(s) 240
TspRI CASTG 2 cut(s) 225, 382
XagI CCTNNNNNAGG 1 cut(s) 108
XapI RAATTY 3 cut(s) 7, 254, 282
XhoI CTCGAG 1 cut(s) 201
XmiI GTMKAC 1 cut(s) 310
XspI CTAG 2 cut(s) 110, 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.