Rh7AG491900

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
69208355 .. 69209319
965 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG491900.1

Sequence Viewer

Length: 267 bp
ATGGTCATGGGTTTAGCTTTACGCTTAGTTTTGGGGCAACAGGTGAATGCAAAAGAGGATAATGTAGATTCTAGTGGAGCAGATCAACAACATTTGCCCAGTTTGAGGACCCTTCTTAAAGTTTACAAGGATGCTATTTTCAATGAAGATGAAAAGACTGTATCTGAGGCAAGGATAGAAGTAATAGAAAATAAGCAAAATGAATTAGTCCAGAAAGTATCGTCTATATCAGCCGAGGTAACATCAGGGAAGGAAACTGCAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.64

Weight (kDa)

4.89

Isoelectric Point (pI)

41.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 1 cut(s) 142
AluBI AGCT 2 cut(s) 17, 264
AluI AGCT 2 cut(s) 17, 264
AspS9I GGNCC 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 55
AvaII GGWCC 1 cut(s) 108
BfaI CTAG 1 cut(s) 72
Bme18I GGWCC 1 cut(s) 108
BmgT120I GGNCC 1 cut(s) 108
BmiI GGNNCC 1 cut(s) 110
BmrI ACTGGG 1 cut(s) 93
BmsI GCATC 1 cut(s) 121
BmuI ACTGGG 1 cut(s) 93
BsaJI CCNNGG 1 cut(s) 234
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 234
BseGI GGATG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 156
BseNI ACTGG 1 cut(s) 99
BslI CCNNNNNNNGG 1 cut(s) 105
BsmI GAATGC 1 cut(s) 52
Bsp143I GATC 1 cut(s) 82
BspCNI CTCAG 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 110
BsrI ACTGG 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 234
BssMI GATC 1 cut(s) 82
Bst4CI ACNGT 1 cut(s) 160
BstC8I GCNNGC 1 cut(s) 262
BstDEI CTNAG 2 cut(s) 25, 165
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BtsCI GGATG 1 cut(s) 136
Cac8I GCNNGC 1 cut(s) 262
Cfr13I GGNCC 1 cut(s) 108
CviAII CATG 1 cut(s) 7
CviJI RGCY 3 cut(s) 17, 233, 264
CviKI_1 RGCY 3 cut(s) 17, 233, 264
DdeI CTNAG 2 cut(s) 25, 165
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eco47I GGWCC 1 cut(s) 108
EcoO109I RGGNCCY 1 cut(s) 108
FaeI CATG 1 cut(s) 10
FaiI YATR 2 cut(s) 8, 227
FatI CATG 1 cut(s) 6
FokI GGATG 1 cut(s) 143
FspBI CTAG 1 cut(s) 72
Hin1II CATG 1 cut(s) 10
HinfI GANTC 1 cut(s) 68
HphI GGTGA 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 166
Hpy188III TCNNGA 1 cut(s) 211
Hpy8I GTNNAC 1 cut(s) 124
HpyAV CCTTC 2 cut(s) 122, 244
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 50, 260
HpyF3I CTNAG 2 cut(s) 25, 165
Hsp92II CATG 1 cut(s) 10
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 4 cut(s) 26, 112, 224, 231
LweI GCATC 1 cut(s) 121
MaeI CTAG 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 238
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 158
MluCI AATT 1 cut(s) 203
MnlI CCTC 4 cut(s) 49, 99, 160, 229
MseI TTAA 1 cut(s) 117
Mva1269I GAATGC 1 cut(s) 52
NdeII GATC 1 cut(s) 82
NlaIII CATG 1 cut(s) 10
NlaIV GGNNCC 1 cut(s) 110
NmeAIII GCCGAG 1 cut(s) 259
PctI GAATGC 1 cut(s) 52
PfeI GAWTC 1 cut(s) 68
PpuMI RGGWCCY 1 cut(s) 108
Psp5II RGGWCCY 1 cut(s) 108
PspN4I GGNNCC 1 cut(s) 110
PspPI GGNCC 1 cut(s) 108
PspPPI RGGWCCY 1 cut(s) 108
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 1 cut(s) 82
Sau96I GGNCC 1 cut(s) 108
SetI ASST 4 cut(s) 19, 45, 240, 266
SfaNI GCATC 1 cut(s) 121
SgeI CNNG 9 cut(s) 19, 53, 84, 111, 139, 183, 223, 247, 258
SinI GGWCC 1 cut(s) 108
Sse9I AATT 1 cut(s) 203
SspMI CTAG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 160
TasI AATT 1 cut(s) 203
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TspDTI ATGAA 3 cut(s) 159, 165, 216
VpaK11BI GGWCC 1 cut(s) 108
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.