Rmu_sc0002551.1_g000025

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002551.1
OG0001161
Physical Location & Seq
Reverse (-)
118875 .. 119910
1036 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002551.1_g000025.1.cds

Sequence Viewer

Length: 303 bp
atggcgaactcgttgtttatctcaaacaactacttcggcatacctcctccttgcgtttctgcttccttctcctcgaaacccatctcttcccccttagttttacatagccgcagcagcagcagcagcaggcgtgcctcgtttttaaaatctcatctttctgctcgaggctctgttcccccagtgaatgccaaagaggataatgtagattctagtggagcagttcaacaacatttgcccagtttgaggaccctccttgaagtttacaaggatgctgttttcaatgaagatgaaaagactgtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GrpE

Protein Analysis

100

Amino Acids

10.79

Weight (kDa)

8.93

Isoelectric Point (pI)

57.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 109
AfiI CCNNNNNNNGG 1 cut(s) 243
AgsI TTSAA 3 cut(s) 224, 257, 280
Ama87I CYCGRG 1 cut(s) 162
ApeKI GCWGC 5 cut(s) 111, 114, 117, 120, 123
AspS9I GGNCC 1 cut(s) 246
AvaI CYCGRG 1 cut(s) 162
AvaII GGWCC 1 cut(s) 246
BbvI GCAGC 5 cut(s) 123, 126, 129, 132, 135
BccI CCATC 1 cut(s) 89
BfaI CTAG 1 cut(s) 210
BisI GCNGC 6 cut(s) 109, 112, 115, 118, 121, 124
BlsI GCNGC 6 cut(s) 110, 113, 116, 119, 122, 125
Bme18I GGWCC 1 cut(s) 246
BmeT110I CYCGRG 1 cut(s) 162
BmgT120I GGNCC 1 cut(s) 246
BmiI GGNNCC 1 cut(s) 248
BmrI ACTGGG 2 cut(s) 173, 231
BmsI GCATC 1 cut(s) 259
BmuI ACTGGG 2 cut(s) 173, 231
Bsc4I CCNNNNNNNGG 1 cut(s) 243
Bse1I ACTGG 2 cut(s) 179, 237
BseGI GGATG 1 cut(s) 274
BseLI CCNNNNNNNGG 1 cut(s) 243
BseNI ACTGG 2 cut(s) 179, 237
BseRI GAGGAG 2 cut(s) 36, 61
BseXI GCAGC 5 cut(s) 123, 126, 129, 132, 135
BsiHKCI CYCGRG 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 243
BsmI GAATGC 1 cut(s) 190
BsoBI CYCGRG 1 cut(s) 162
BspACI CCGC 1 cut(s) 109
BspLI GGNNCC 1 cut(s) 248
BsrI ACTGG 2 cut(s) 179, 237
Bst4CI ACNGT 1 cut(s) 298
Bst6I CTCTTC 1 cut(s) 91
BstC8I GCNNGC 2 cut(s) 128, 132
BstDEI CTNAG 1 cut(s) 94
BstF5I GGATG 1 cut(s) 274
BstMWI GCNNNNNNNGC 4 cut(s) 114, 117, 120, 123
BstV1I GCAGC 5 cut(s) 123, 126, 129, 132, 135
BtsCI GGATG 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 186
Cac8I GCNNGC 2 cut(s) 128, 132
Cfr13I GGNCC 1 cut(s) 246
CviJI RGCY 2 cut(s) 108, 168
CviKI_1 RGCY 2 cut(s) 108, 168
DdeI CTNAG 1 cut(s) 94
DraI TTTAAA 1 cut(s) 144
Eam1104I CTCTTC 1 cut(s) 91
EarI CTCTTC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 246
Eco88I CYCGRG 1 cut(s) 162
EcoO109I RGGNCCY 1 cut(s) 246
FaiI YATR 2 cut(s) 41, 105
Fnu4HI GCNGC 6 cut(s) 109, 112, 115, 118, 121, 124
FokI GGATG 1 cut(s) 281
Fsp4HI GCNGC 6 cut(s) 109, 112, 115, 118, 121, 124
FspBI CTAG 1 cut(s) 210
GluI GCNGC 6 cut(s) 109, 112, 115, 118, 121, 124
HinfI GANTC 1 cut(s) 206
Hpy166II GTNNAC 1 cut(s) 262
Hpy8I GTNNAC 1 cut(s) 262
HpyAV CCTTC 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 298
HpyF10VI GCNNNNNNNGC 4 cut(s) 114, 117, 120, 123
HpyF3I CTNAG 1 cut(s) 94
LmnI GCTCC 1 cut(s) 215
LpnPI CCDG 3 cut(s) 112, 192, 250
Lsp1109I GCAGC 5 cut(s) 123, 126, 129, 132, 135
LweI GCATC 1 cut(s) 259
MaeI CTAG 1 cut(s) 210
MboII GAAGA 2 cut(s) 78, 296
MnlI CCTC 8 cut(s) 54, 57, 82, 145, 158, 187, 237, 260
MseI TTAA 1 cut(s) 143
Mva1269I GAATGC 1 cut(s) 190
MwoI GCNNNNNNNGC 4 cut(s) 114, 117, 120, 123
NlaIV GGNNCC 1 cut(s) 248
PaeR7I CTCGAG 1 cut(s) 162
PctI GAATGC 1 cut(s) 190
PfeI GAWTC 1 cut(s) 206
PkrI GCNGC 6 cut(s) 110, 113, 116, 119, 122, 125
PpuMI RGGWCCY 1 cut(s) 246
Psp5II RGGWCCY 1 cut(s) 246
PspN4I GGNNCC 1 cut(s) 248
PspPI GGNCC 1 cut(s) 246
PspPPI RGGWCCY 1 cut(s) 246
PspXI VCTCGAGB 1 cut(s) 162
SaqAI TTAA 1 cut(s) 143
SatI GCNGC 6 cut(s) 109, 112, 115, 118, 121, 124
Sau96I GGNCC 1 cut(s) 246
SetI ASST 1 cut(s) 46
SfaNI GCATC 1 cut(s) 259
Sfr274I CTCGAG 1 cut(s) 162
SinI GGWCC 1 cut(s) 246
SlaI CTCGAG 1 cut(s) 162
SmlI CTYRAG 1 cut(s) 162
SmoI CTYRAG 1 cut(s) 162
SsiI CCGC 1 cut(s) 109
SspMI CTAG 1 cut(s) 210
TaaI ACNGT 1 cut(s) 298
TaqI TCGA 2 cut(s) 74, 163
TauI GCSGC 1 cut(s) 111
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TscAI CASTG 1 cut(s) 186
TseI GCWGC 5 cut(s) 111, 114, 117, 120, 123
TspDTI ATGAA 2 cut(s) 297, 303
TspRI CASTG 1 cut(s) 186
VpaK11BI GGWCC 1 cut(s) 246
XhoI CTCGAG 1 cut(s) 162
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.