Rmu_sc0020449.1_g000001

Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020449.1
OG0001161
Physical Location & Seq
Forward (+)
343 .. 2386
2044 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020449.1_g000001.1.cds

Sequence Viewer

Length: 522 bp
atggttgacaattttgagagagcaaaacaacaaattagatctgaaactgaaaatgagaaggaaattgatacaagttaccagggtatatacaagcaatttgttgagattatgaagagtttgcgtgtgtcacctgtgccagctatgggaaaaccctttgatccttcggtgcatgaagctattgcacgagaagagtttcaagaattcccaaaggggattgtcattcaagaaattcgccgtggctttttacttggtgatcaacttctaagaccagcaatgattaaagtctctatagggcctggcagtaagaagacccctgtgcatgaagctattgcacgagaagagtctcaagaattcccaaaggggattgtcattcaagaaattcgccgtggctttttacttggtgatcaacttctaagaccagcaatgattaaagtctctatagggcctggcagtaagaagacccctgtggccactttgaaatcatcagggtcacctgcaacagctgcttcggtacagaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GrpE

Protein Analysis

173

Amino Acids

19.17

Weight (kDa)

9.36

Isoelectric Point (pI)

55.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 502
Acc36I ACCTGC 1 cut(s) 502
AclWI GGATC 1 cut(s) 152
AcoI YGGCCR 1 cut(s) 468
AcsI RAATTY 4 cut(s) 200, 228, 350, 378
AfaI GTAC 1 cut(s) 513
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 4 cut(s) 197, 224, 374, 478
AjnI CCWGG 3 cut(s) 78, 295, 445
AluBI AGCT 4 cut(s) 140, 176, 326, 503
AluI AGCT 4 cut(s) 140, 176, 326, 503
Alw26I GTCTC 3 cut(s) 289, 348, 439
AlwI GGATC 1 cut(s) 152
AoxI GGCC 3 cut(s) 293, 443, 468
ApeKI GCWGC 1 cut(s) 503
ApoI RAATTY 4 cut(s) 200, 228, 350, 378
Asp700I GAANNNNTTC 1 cut(s) 192
AspS9I GGNCC 2 cut(s) 293, 443
AsuHPI GGTGA 4 cut(s) 120, 263, 413, 483
BalI TGGCCA 1 cut(s) 470
BauI CACGAG 2 cut(s) 183, 333
BbsI GAAGAC 2 cut(s) 314, 464
BbvI GCAGC 1 cut(s) 490
BceAI ACGGC 2 cut(s) 219, 369
BciT130I CCWGG 3 cut(s) 80, 297, 447
BclI TGATCA 2 cut(s) 253, 403
BcoDI GTCTC 3 cut(s) 289, 348, 439
BfmI CTRYAG 2 cut(s) 288, 438
BfuAI ACCTGC 1 cut(s) 502
BglII AGATCT 1 cut(s) 38
BisI GCNGC 1 cut(s) 504
BlsI GCNGC 1 cut(s) 505
Bme1390I CCNGG 3 cut(s) 80, 297, 447
BmgT120I GGNCC 2 cut(s) 293, 443
BmrFI CCNGG 3 cut(s) 80, 297, 447
BpiI GAAGAC 2 cut(s) 314, 464
BpuEI CTTGAG 1 cut(s) 330
BsaJI CCNNGG 3 cut(s) 79, 235, 385
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse3DI GCAATG 2 cut(s) 279, 429
BseBI CCWGG 3 cut(s) 80, 297, 447
BseDI CCNNGG 3 cut(s) 79, 235, 385
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMI GCAATG 2 cut(s) 279, 429
BseXI GCAGC 1 cut(s) 490
BshFI GGCC 3 cut(s) 295, 445, 470
BslI CCNNNNNNNGG 1 cut(s) 143
BsmAI GTCTC 3 cut(s) 289, 348, 439
BsnI GGCC 3 cut(s) 295, 445, 470
Bsp143I GATC 4 cut(s) 38, 157, 253, 403
BspANI GGCC 3 cut(s) 295, 445, 470
BspMI ACCTGC 1 cut(s) 502
BspPI GGATC 1 cut(s) 152
BsrDI GCAATG 2 cut(s) 279, 429
BssECI CCNNGG 3 cut(s) 79, 235, 385
BssMI GATC 4 cut(s) 38, 157, 253, 403
BssSI CACGAG 2 cut(s) 183, 333
Bst2BI CACGAG 2 cut(s) 183, 333
Bst2UI CCWGG 3 cut(s) 80, 297, 447
Bst6I CTCTTC 3 cut(s) 107, 183, 333
BstAPI GCANNNNNTGC 1 cut(s) 503
BstC8I GCNNGC 1 cut(s) 138
BstDEI CTNAG 2 cut(s) 263, 413
BstDSI CCRYGG 2 cut(s) 235, 385
BstEII GGTNACC 1 cut(s) 489
BstKTI GATC 4 cut(s) 41, 160, 256, 406
BstMAI GTCTC 3 cut(s) 289, 348, 439
BstMBI GATC 4 cut(s) 38, 157, 253, 403
BstMWI GCNNNNNNNGC 1 cut(s) 503
BstNI CCWGG 3 cut(s) 80, 297, 447
BstPI GGTNACC 1 cut(s) 489
BstSCI CCNGG 3 cut(s) 78, 295, 445
BstSFI CTRYAG 2 cut(s) 288, 438
BstV1I GCAGC 1 cut(s) 490
BstV2I GAAGAC 2 cut(s) 314, 464
BstX2I RGATCY 1 cut(s) 38
BstYI RGATCY 1 cut(s) 38
BsuRI GGCC 3 cut(s) 295, 445, 470
BtgI CCRYGG 2 cut(s) 235, 385
BveI ACCTGC 1 cut(s) 502
Cac8I GCNNGC 1 cut(s) 138
Cfr13I GGNCC 2 cut(s) 293, 443
Csp6I GTAC 1 cut(s) 512
CviAII CATG 2 cut(s) 170, 320
CviJI RGCY 9 cut(s) 140, 176, 240, 295, 326, 390, 445, 470, 503
CviKI_1 RGCY 9 cut(s) 140, 176, 240, 295, 326, 390, 445, 470, 503
CviQI GTAC 1 cut(s) 512
DdeI CTNAG 2 cut(s) 263, 413
DpnI GATC 4 cut(s) 40, 159, 255, 405
DpnII GATC 4 cut(s) 38, 157, 253, 403
EaeI YGGCCR 1 cut(s) 468
Eam1104I CTCTTC 3 cut(s) 107, 183, 333
EarI CTCTTC 3 cut(s) 107, 183, 333
Eco91I GGTNACC 1 cut(s) 489
EcoO109I RGGNCCY 2 cut(s) 293, 443
EcoO65I GGTNACC 1 cut(s) 489
EcoRI GAATTC 2 cut(s) 200, 350
EcoRII CCWGG 3 cut(s) 78, 295, 445
FaeI CATG 2 cut(s) 173, 323
FaiI YATR 8 cut(s) 86, 88, 110, 143, 171, 290, 321, 440
FatI CATG 2 cut(s) 169, 319
FbaI TGATCA 2 cut(s) 253, 403
Fnu4HI GCNGC 1 cut(s) 504
Fsp4HI GCNGC 1 cut(s) 504
GluI GCNGC 1 cut(s) 504
HaeIII GGCC 3 cut(s) 295, 445, 470
Hin1II CATG 2 cut(s) 173, 323
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
HinfI GANTC 1 cut(s) 341
HphI GGTGA 4 cut(s) 120, 263, 413, 483
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 4 cut(s) 197, 224, 347, 374
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 2 cut(s) 52, 171
HpyCH4V TGCA 5 cut(s) 169, 182, 319, 332, 497
HpyF10VI GCNNNNNNNGC 1 cut(s) 503
HpyF3I CTNAG 2 cut(s) 263, 413
Hsp92II CATG 2 cut(s) 173, 323
Ksp22I TGATCA 2 cut(s) 253, 403
Kzo9I GATC 4 cut(s) 38, 157, 253, 403
Lsp1109I GCAGC 1 cut(s) 490
MaeIII GTNAC 3 cut(s) 74, 126, 489
MalI GATC 4 cut(s) 40, 159, 255, 405
MboI GATC 4 cut(s) 38, 157, 253, 403
MboII GAAGA 5 cut(s) 124, 200, 319, 350, 469
MflI RGATCY 1 cut(s) 38
MlsI TGGCCA 1 cut(s) 470
MluCI AATT 9 cut(s) 10, 33, 63, 95, 200, 228, 350, 378, 517
MluNI TGGCCA 1 cut(s) 470
MlyI GAGTC 1 cut(s) 350
Mox20I TGGCCA 1 cut(s) 470
MroXI GAANNNNTTC 1 cut(s) 192
MscI TGGCCA 1 cut(s) 470
MseI TTAA 2 cut(s) 279, 429
Msp20I TGGCCA 1 cut(s) 470
MspA1I CMGCKG 1 cut(s) 503
MspR9I CCNGG 3 cut(s) 80, 297, 447
MvaI CCWGG 3 cut(s) 80, 297, 447
MwoI GCNNNNNNNGC 1 cut(s) 503
NdeII GATC 4 cut(s) 38, 157, 253, 403
NlaIII CATG 2 cut(s) 173, 323
NmuCI GTSAC 2 cut(s) 126, 489
PaqCI CACCTGC 1 cut(s) 502
PdmI GAANNNNTTC 1 cut(s) 192
PkrI GCNGC 1 cut(s) 505
PleI GAGTC 1 cut(s) 349
PpsI GAGTC 1 cut(s) 349
Psp6I CCWGG 3 cut(s) 78, 295, 445
PspEI GGTNACC 1 cut(s) 489
PspGI CCWGG 3 cut(s) 78, 295, 445
PspPI GGNCC 2 cut(s) 293, 443
PsuI RGATCY 1 cut(s) 38
PvuII CAGCTG 1 cut(s) 503
RsaI GTAC 1 cut(s) 513
RsaNI GTAC 1 cut(s) 512
SaqAI TTAA 2 cut(s) 279, 429
SatI GCNGC 1 cut(s) 504
Sau3AI GATC 4 cut(s) 38, 157, 253, 403
Sau96I GGNCC 2 cut(s) 293, 443
SchI GAGTC 1 cut(s) 350
ScrFI CCNGG 3 cut(s) 80, 297, 447
SetI ASST 6 cut(s) 133, 142, 178, 328, 496, 505
SfcI CTRYAG 2 cut(s) 288, 438
SmlI CTYRAG 1 cut(s) 345
SmoI CTYRAG 1 cut(s) 345
Sse9I AATT 9 cut(s) 10, 33, 63, 95, 200, 228, 350, 378, 517
StyD4I CCNGG 3 cut(s) 78, 295, 445
TasI AATT 9 cut(s) 10, 33, 63, 95, 200, 228, 350, 378, 517
Tru1I TTAA 2 cut(s) 279, 429
Tru9I TTAA 2 cut(s) 279, 429
TseFI GTSAC 2 cut(s) 126, 489
TseI GCWGC 1 cut(s) 503
Tsp45I GTSAC 2 cut(s) 126, 489
TspDTI ATGAA 3 cut(s) 125, 186, 336
XapI RAATTY 4 cut(s) 200, 228, 350, 378
XmnI GAANNNNTTC 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.