MD09G1024300.v1.1

Altered inheritance of mitochondria protein 32-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
1465424 .. 1467237
1814 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1024300.v1.1.491

Sequence Viewer

Length: 318 bp
ATGGAAGCTGAGCTGCGAGGATTGACAAATCAGGTATTTGTTACTGCTTGCTCTCACATTGGAGACCACAAGTGTGCTGGAAACTTGATTGTCTACAGCCCAGGTTCAGATGGAAGCATAACAGGCCATTGGTATGGCTACGTCACTCCTAAGGATGTGCCGGAATTGCTTGATCAGCATATTGGGAAGGGAGAGATCATAGAACGACTTTGGAGGATTAGGGGCCAAATGGGAGCATCTTCGGATGAAGCTGAAAAAATTAATGACCAGAAGCTTCCAAATGGAGGAGAAAGTAAGAAAATGGAGGAGAAGCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.57

Weight (kDa)

5.5

Isoelectric Point (pI)

36.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Suc_Fer-like PF06999 9 - 72 1e-16 Sucrase/ferredoxin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 284
AjnI CCWGG 1 cut(s) 100
AleI CACNNNNGTG 1 cut(s) 72
AluBI AGCT 4 cut(s) 8, 13, 251, 274
AluI AGCT 4 cut(s) 8, 13, 251, 274
Alw26I GTCTC 1 cut(s) 57
AoxI GGCC 2 cut(s) 124, 223
ApeKI GCWGC 1 cut(s) 13
AseI ATTAAT 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 223
AxyI CCTNAGG 1 cut(s) 150
BccI CCATC 1 cut(s) 104
BciT130I CCWGG 1 cut(s) 102
BclI TGATCA 1 cut(s) 172
BcoDI GTCTC 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 94
BisI GCNGC 1 cut(s) 14
BlpI GCTNAGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 224
BmrFI CCNGG 1 cut(s) 102
BmsI GCATC 1 cut(s) 245
Bpu1102I GCTNAGC 1 cut(s) 9
BsaI GGTCTC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 100
Bsc4I CCNNNNNNNGG 1 cut(s) 284
Bse21I CCTNAGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 100
BseGI GGATG 2 cut(s) 160, 250
BseLI CCNNNNNNNGG 1 cut(s) 284
BseRI GAGGAG 1 cut(s) 300
BshFI GGCC 2 cut(s) 126, 225
BsiSI CCGG 1 cut(s) 161
BslI CCNNNNNNNGG 1 cut(s) 284
BsmAI GTCTC 1 cut(s) 57
BsnI GGCC 2 cut(s) 126, 225
Bso31I GGTCTC 1 cut(s) 57
Bsp143I GATC 2 cut(s) 172, 195
Bsp1720I GCTNAGC 1 cut(s) 9
BspANI GGCC 2 cut(s) 126, 225
BspLI GGNNCC 1 cut(s) 224
BspTNI GGTCTC 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 100
BssMI GATC 2 cut(s) 172, 195
Bst2UI CCWGG 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 49
BstDEI CTNAG 2 cut(s) 9, 150
BstF5I GGATG 2 cut(s) 160, 250
BstKTI GATC 2 cut(s) 175, 198
BstMAI GTCTC 1 cut(s) 57
BstMBI GATC 2 cut(s) 172, 195
BstMWI GCNNNNNNNGC 3 cut(s) 123, 166, 175
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstSFI CTRYAG 1 cut(s) 94
BstXI CCANNNNNNTGG 1 cut(s) 134
Bsu36I CCTNAGG 1 cut(s) 150
BsuRI GGCC 2 cut(s) 126, 225
BtsCI GGATG 2 cut(s) 160, 250
Cac8I GCNNGC 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 223
CviJI RGCY 9 cut(s) 8, 13, 99, 126, 138, 225, 251, 274, 313
CviKI_1 RGCY 9 cut(s) 8, 13, 99, 126, 138, 225, 251, 274, 313
DdeI CTNAG 2 cut(s) 9, 150
DpnI GATC 2 cut(s) 174, 197
DpnII GATC 2 cut(s) 172, 195
Eco31I GGTCTC 1 cut(s) 57
Eco81I CCTNAGG 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 100
FaiI YATR 4 cut(s) 119, 135, 180, 200
FbaI TGATCA 1 cut(s) 172
FblI GTMKAC 1 cut(s) 93
Fnu4HI GCNGC 1 cut(s) 14
FokI GGATG 2 cut(s) 167, 257
Fsp4HI GCNGC 1 cut(s) 14
GluI GCNGC 1 cut(s) 14
HaeIII GGCC 2 cut(s) 126, 225
HapII CCGG 1 cut(s) 161
HindIII AAGCTT 1 cut(s) 272
HpaII CCGG 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 109, 244
Hpy8I GTNNAC 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 181
HpyCH4IV ACGT 1 cut(s) 141
HpyF10VI GCNNNNNNNGC 3 cut(s) 123, 166, 175
HpyF3I CTNAG 2 cut(s) 9, 150
HpySE526I ACGT 1 cut(s) 141
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 2 cut(s) 172, 195
LmnI GCTCC 1 cut(s) 233
LpnPI CCDG 7 cut(s) 17, 63, 87, 108, 114, 174, 281
LweI GCATC 1 cut(s) 245
MaeII ACGT 1 cut(s) 141
MaeIII GTNAC 2 cut(s) 40, 142
MalI GATC 2 cut(s) 174, 197
MboI GATC 2 cut(s) 172, 195
MboII GAAGA 1 cut(s) 231
MluCI AATT 2 cut(s) 164, 258
MnlI CCTC 4 cut(s) 11, 207, 278, 298
MseI TTAA 1 cut(s) 261
MslI CAYNNNNRTG 2 cut(s) 72, 132
MspI CCGG 1 cut(s) 161
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
MwoI GCNNNNNNNGC 3 cut(s) 123, 166, 175
NdeII GATC 2 cut(s) 172, 195
NlaIV GGNNCC 1 cut(s) 224
NmuCI GTSAC 1 cut(s) 142
OliI CACNNNNGTG 1 cut(s) 72
PkrI GCNGC 1 cut(s) 15
PshBI ATTAAT 1 cut(s) 261
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 223
RseI CAYNNNNRTG 2 cut(s) 72, 132
SaqAI TTAA 1 cut(s) 261
SatI GCNGC 1 cut(s) 14
Sau3AI GATC 2 cut(s) 172, 195
Sau96I GGNCC 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 102
SetI ASST 7 cut(s) 10, 15, 36, 106, 144, 253, 276
SfaNI GCATC 1 cut(s) 245
SfcI CTRYAG 1 cut(s) 94
SmiMI CAYNNNNRTG 2 cut(s) 72, 132
Sse9I AATT 2 cut(s) 164, 258
StyD4I CCNGG 1 cut(s) 100
TaiI ACGT 1 cut(s) 144
TasI AATT 2 cut(s) 164, 258
Tru1I TTAA 1 cut(s) 261
Tru9I TTAA 1 cut(s) 261
TseFI GTSAC 1 cut(s) 142
TseI GCWGC 1 cut(s) 13
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 261
VspI ATTAAT 1 cut(s) 261
XcmI CCANNNNNNNNNTGG 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.