MD09G1044600.v1.1

Altered inheritance of mitochondria protein 32-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
2890108 .. 2890382
275 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1044600.v1.1.491

Sequence Viewer

Length: 192 bp
ATGGATAAGTTCAAAGAGGAGGCTGAGCTGCGAGGATTGACGAATCATGTATTTGTTACTGCTTGCTCTTACATTGAAGGCCACAAATATGCTGGAAACTTGATTATCTACAGCCTGGGTTCAGATGGAAGCATAACAGGCCATTGGTATGGCTATGTCACTCCTGACAATGTGCCGGAATTGCTTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.04

Weight (kDa)

4.87

Isoelectric Point (pI)

28.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Suc_Fer-like PF06999 4 - 63 1.6e-12 Sucrase/ferredoxin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 13, 77
AjnI CCWGG 1 cut(s) 114
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
AoxI GGCC 2 cut(s) 79, 139
ApeKI GCWGC 1 cut(s) 28
BbvI GCAGC 1 cut(s) 15
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 116
BfmI CTRYAG 1 cut(s) 109
BisI GCNGC 1 cut(s) 29
BlpI GCTNAGC 1 cut(s) 24
BlsI GCNGC 1 cut(s) 30
Bme1390I CCNGG 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 116
Bpu1102I GCTNAGC 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 115
BseMII CTCAG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 1 cut(s) 15
BshFI GGCC 2 cut(s) 81, 141
BsiSI CCGG 1 cut(s) 176
BsnI GGCC 2 cut(s) 81, 141
Bsp1720I GCTNAGC 1 cut(s) 24
BspANI GGCC 2 cut(s) 81, 141
BspCNI CTCAG 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 115
Bst2UI CCWGG 1 cut(s) 116
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 24
BstMWI GCNNNNNNNGC 2 cut(s) 138, 181
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstSFI CTRYAG 1 cut(s) 109
BstV1I GCAGC 1 cut(s) 15
BstXI CCANNNNNNTGG 1 cut(s) 149
BsuRI GGCC 2 cut(s) 81, 141
Cac8I GCNNGC 1 cut(s) 64
CviAII CATG 1 cut(s) 47
CviJI RGCY 6 cut(s) 23, 28, 81, 114, 141, 153
CviKI_1 RGCY 6 cut(s) 23, 28, 81, 114, 141, 153
DdeI CTNAG 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 114
FaeI CATG 1 cut(s) 50
FaiI YATR 5 cut(s) 48, 90, 134, 150, 156
FatI CATG 1 cut(s) 46
Fnu4HI GCNGC 1 cut(s) 29
Fsp4HI GCNGC 1 cut(s) 29
GluI GCNGC 1 cut(s) 29
HaeIII GGCC 2 cut(s) 81, 141
HapII CCGG 1 cut(s) 176
Hin1II CATG 1 cut(s) 50
HinfI GANTC 1 cut(s) 43
HpaII CCGG 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 1 cut(s) 164
HpyAV CCTTC 1 cut(s) 71
HpyF10VI GCNNNNNNNGC 2 cut(s) 138, 181
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 1 cut(s) 50
LpnPI CCDG 5 cut(s) 78, 101, 123, 128, 177
Lsp1109I GCAGC 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 55, 157
MluCI AATT 1 cut(s) 179
MnlI CCTC 3 cut(s) 10, 13, 26
MslI CAYNNNNRTG 2 cut(s) 87, 147
MspI CCGG 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 116
MvaI CCWGG 1 cut(s) 116
MwoI GCNNNNNNNGC 2 cut(s) 138, 181
NlaIII CATG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 157
PfeI GAWTC 1 cut(s) 43
PkrI GCNGC 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
RseI CAYNNNNRTG 2 cut(s) 87, 147
SatI GCNGC 1 cut(s) 29
ScrFI CCNGG 1 cut(s) 116
SetI ASST 1 cut(s) 30
SfcI CTRYAG 1 cut(s) 109
SmiMI CAYNNNNRTG 2 cut(s) 87, 147
Sse9I AATT 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 114
TasI AATT 1 cut(s) 179
TfiI GAWTC 1 cut(s) 43
TseFI GTSAC 1 cut(s) 157
TseI GCWGC 1 cut(s) 28
Tsp45I GTSAC 1 cut(s) 157
XcmI CCANNNNNNNNNTGG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.