Rorug01G0115900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0001205
Physical Location & Seq
Forward (+)
20367799 .. 20373226
5428 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0115900.1

Sequence Viewer

Length: 681 bp
ATGATATCGTCAGGGGTTAACCTGGCGATGACGGTGATTGGTTTCGCAGTGAGCACCATGTTCATCGTCTTTGTGTGCACCAGGCTTATTTGTGCTCGGATTCACCTCAATGTTTCAAGACGCTCCTTCCCCACAGCTTCTAGATCCGATCTCAGTATTCTAGAACGGGGTTTACATGGCGTTGAACCTGTAGCTGTAGCCAACTTTCCAACAAAGAAGTACAATGATCCATTTTTTTCAGCAGTTGAAGATGCTCAATGTACAGTTTGCCTCGCAGAATACCATGGCGATGATGTATTGCGGATCCTCCCTTATTGTGGGCACTCATTCCATGTGACCTGTATAGACATATGGCTTCATCAGCATTCCACGTGTCCTGTTTGTAGAATATCATTGCGCGAGCATCCTGAGAGAAAACATCGTCTGCAACCCTTGTTCAGTTCAGCTATTCGATCTCATTATGGTACAGAATCCTCTGACATCCATTCTTATCGCTATCCTTTGAACAATCATGGATCAAGAACACATGCCAACCGTAGTATGGACCCTATTCAAGAGGATCATATAGCATCTGAGGGTGATGGATCAGATGCCAGGGAGAATGCCTTGCCCTTAAATGAGAGTAATCTGAATTCTAAGGACATGACAAACAAGCACGTAGAAAGCCCATCAAATCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

226

Amino Acids

25.31

Weight (kDa)

6.55

Isoelectric Point (pI)

53.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RING_2 PF13639 86 - 129 1e-13 Ring finger domain
zf-rbx1 PF12678 86 - 129 9.3e-09 RING-H2 zinc finger domain
zf-RING_11 PF17123 86 - 115 2.2e-08 RING-like zinc finger
zf-C3HC4_2 PF13923 86 - 128 1.1e-06 Zinc finger, C3HC4 type (RING finger)
zf-ANAPC11 PF12861 86 - 131 5.4e-06 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-C3HC4 PF00097 87 - 128 7.2e-06 Zinc finger, C3HC4 type (RING finger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 399
AciI CCGC 1 cut(s) 301
AclWI GGATC 7 cut(s) 138, 221, 298, 311, 523, 567, 592
AcsI RAATTY 1 cut(s) 631
AcvI CACGTG 1 cut(s) 372
AfaI GTAC 3 cut(s) 221, 262, 466
AfiI CCNNNNNNNGG 2 cut(s) 317, 541
AflIII ACRYGT 1 cut(s) 371
AgsI TTSAA 5 cut(s) 117, 185, 248, 505, 554
AjnI CCWGG 3 cut(s) 21, 80, 593
AluBI AGCT 3 cut(s) 137, 194, 446
AluI AGCT 3 cut(s) 137, 194, 446
Alw21I GWGCWC 3 cut(s) 56, 80, 97
Alw44I GTGCAC 1 cut(s) 76
AlwI GGATC 7 cut(s) 138, 221, 298, 311, 523, 567, 592
ApaLI GTGCAC 1 cut(s) 76
ApoI RAATTY 1 cut(s) 631
AspLEI GCGC 1 cut(s) 399
AspS9I GGNCC 1 cut(s) 544
AsuHPI GGTGA 3 cut(s) 46, 95, 590
AvaII GGWCC 1 cut(s) 544
BaeGI GKGCMC 2 cut(s) 80, 324
BamHI GGATCC 1 cut(s) 303
BbrPI CACGTG 1 cut(s) 372
Bbv12I GWGCWC 3 cut(s) 56, 80, 97
BccI CCATC 2 cut(s) 575, 676
BciT130I CCWGG 3 cut(s) 23, 82, 595
BfaI CTAG 2 cut(s) 141, 161
BfmI CTRYAG 2 cut(s) 189, 195
Bme1390I CCNGG 3 cut(s) 23, 82, 595
Bme18I GGWCC 1 cut(s) 544
BmgT120I GGNCC 1 cut(s) 544
BmiI GGNNCC 2 cut(s) 305, 546
BmrFI CCNGG 3 cut(s) 23, 82, 595
BmsI GCATC 4 cut(s) 241, 412, 578, 580
BsaAI YACGTR 2 cut(s) 372, 658
BsaJI CCNNGG 2 cut(s) 283, 594
Bsc4I CCNNNNNNNGG 2 cut(s) 317, 541
Bse3DI GCAATG 1 cut(s) 392
BseBI CCWGG 3 cut(s) 23, 82, 595
BseDI CCNNGG 2 cut(s) 283, 594
BseGI GGATG 2 cut(s) 403, 480
BseLI CCNNNNNNNGG 2 cut(s) 317, 541
BseMI GCAATG 1 cut(s) 392
BseMII CTCAG 3 cut(s) 166, 399, 564
BseSI GKGCMC 2 cut(s) 80, 324
Bsh1236I CGCG 1 cut(s) 399
BsiHKAI GWGCWC 3 cut(s) 56, 80, 97
BslI CCNNNNNNNGG 2 cut(s) 317, 541
BsmI GAATGC 2 cut(s) 364, 607
Bsp1286I GDGCHC 4 cut(s) 56, 80, 97, 324
Bsp1407I TGTACA 1 cut(s) 260
Bsp143I GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
Bsp19I CCATGG 1 cut(s) 283
BspACI CCGC 1 cut(s) 301
BspCNI CTCAG 3 cut(s) 165, 400, 565
BspFNI CGCG 1 cut(s) 399
BspLI GGNNCC 2 cut(s) 305, 546
BspPI GGATC 7 cut(s) 138, 221, 298, 311, 523, 567, 592
BsrDI GCAATG 1 cut(s) 392
BsrGI TGTACA 1 cut(s) 260
BssECI CCNNGG 2 cut(s) 283, 594
BssMI GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
BssT1I CCWWGG 1 cut(s) 283
Bst2UI CCWGG 3 cut(s) 23, 82, 595
Bst4CI ACNGT 3 cut(s) 34, 265, 536
BstAUI TGTACA 1 cut(s) 260
BstBAI YACGTR 2 cut(s) 372, 658
BstC8I GCNNGC 1 cut(s) 401
BstDEI CTNAG 4 cut(s) 152, 408, 573, 636
BstDSI CCRYGG 1 cut(s) 283
BstF5I GGATG 2 cut(s) 403, 480
BstFNI CGCG 1 cut(s) 399
BstHHI GCGC 1 cut(s) 399
BstKTI GATC 8 cut(s) 146, 151, 229, 306, 455, 518, 562, 587
BstMBI GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
BstMWI GCNNNNNNNGC 1 cut(s) 361
BstNI CCWGG 3 cut(s) 23, 82, 595
BstNSI RCATGY 1 cut(s) 530
BstSCI CCNGG 3 cut(s) 21, 80, 593
BstSFI CTRYAG 2 cut(s) 189, 195
BstSLI GKGCMC 2 cut(s) 80, 324
BstUI CGCG 1 cut(s) 399
BstX2I RGATCY 2 cut(s) 143, 303
BstYI RGATCY 2 cut(s) 143, 303
BtgI CCRYGG 1 cut(s) 283
BtgZI GCGATG 2 cut(s) 41, 303
BtsCI GGATG 2 cut(s) 403, 480
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 401
CfoI GCGC 1 cut(s) 399
Cfr13I GGNCC 1 cut(s) 544
CseI GACGC 1 cut(s) 129
Csp6I GTAC 3 cut(s) 220, 261, 465
CviAII CATG 7 cut(s) 58, 176, 284, 332, 512, 527, 643
CviJI RGCY 7 cut(s) 85, 137, 194, 200, 355, 446, 666
CviKI_1 RGCY 7 cut(s) 85, 137, 194, 200, 355, 446, 666
CviQI GTAC 3 cut(s) 220, 261, 465
DdeI CTNAG 4 cut(s) 152, 408, 573, 636
DpnI GATC 8 cut(s) 145, 150, 228, 305, 454, 517, 561, 586
DpnII GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
Eco130I CCWWGG 1 cut(s) 283
Eco32I GATATC 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 544
Eco72I CACGTG 1 cut(s) 372
EcoRI GAATTC 1 cut(s) 631
EcoRII CCWGG 3 cut(s) 21, 80, 593
EcoRV GATATC 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 283
ErhI CCWWGG 1 cut(s) 283
FaeI CATG 7 cut(s) 61, 179, 287, 335, 515, 530, 646
FatI CATG 7 cut(s) 57, 175, 283, 331, 511, 526, 642
FauNDI CATATG 1 cut(s) 350
FokI GGATG 2 cut(s) 390, 467
FspBI CTAG 2 cut(s) 141, 161
GlaI GCGC 1 cut(s) 398
HgaI GACGC 1 cut(s) 129
HhaI GCGC 1 cut(s) 399
Hin1II CATG 7 cut(s) 61, 179, 287, 335, 515, 530, 646
Hin6I GCGC 1 cut(s) 397
HinP1I GCGC 1 cut(s) 397
HincII GTYRAC 1 cut(s) 19
HindII GTYRAC 1 cut(s) 19
HinfI GANTC 2 cut(s) 100, 470
HpaI GTTAAC 1 cut(s) 19
HphI GGTGA 3 cut(s) 46, 95, 590
Hpy166II GTNNAC 3 cut(s) 19, 78, 173
Hpy188I TCNGA 6 cut(s) 99, 148, 478, 574, 589, 630
Hpy188III TCNNGA 6 cut(s) 117, 141, 161, 407, 519, 554
Hpy8I GTNNAC 3 cut(s) 19, 78, 173
HpyAV CCTTC 1 cut(s) 136
HpyCH4III ACNGT 3 cut(s) 34, 265, 536
HpyCH4IV ACGT 2 cut(s) 371, 657
HpyCH4V TGCA 2 cut(s) 78, 427
HpyF10VI GCNNNNNNNGC 1 cut(s) 361
HpyF3I CTNAG 4 cut(s) 152, 408, 573, 636
HpySE526I ACGT 2 cut(s) 371, 657
Hsp92II CATG 7 cut(s) 61, 179, 287, 335, 515, 530, 646
HspAI GCGC 1 cut(s) 397
KspAI GTTAAC 1 cut(s) 19
Kzo9I GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
LmnI GCTCC 1 cut(s) 128
LweI GCATC 4 cut(s) 241, 412, 578, 580
MaeI CTAG 2 cut(s) 141, 161
MaeII ACGT 2 cut(s) 371, 657
MaeIII GTNAC 1 cut(s) 334
MalI GATC 8 cut(s) 145, 150, 228, 305, 454, 517, 561, 586
MboI GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
MboII GAAGA 1 cut(s) 260
MflI RGATCY 2 cut(s) 143, 303
MhlI GDGCHC 4 cut(s) 56, 80, 97, 324
MluCI AATT 1 cut(s) 631
MmeI TCCRAC 1 cut(s) 233
MnlI CCTC 6 cut(s) 116, 281, 317, 484, 550, 568
MseI TTAA 2 cut(s) 18, 614
MslI CAYNNNNRTG 2 cut(s) 108, 288
MspR9I CCNGG 3 cut(s) 23, 82, 595
Mva1269I GAATGC 2 cut(s) 364, 607
MvaI CCWGG 3 cut(s) 23, 82, 595
MvnI CGCG 1 cut(s) 399
MwoI GCNNNNNNNGC 1 cut(s) 361
NcoI CCATGG 1 cut(s) 283
NdeI CATATG 1 cut(s) 350
NdeII GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
NlaIII CATG 7 cut(s) 61, 179, 287, 335, 515, 530, 646
NlaIV GGNNCC 2 cut(s) 305, 546
NmuCI GTSAC 1 cut(s) 334
NspI RCATGY 1 cut(s) 530
PctI GAATGC 2 cut(s) 364, 607
PfeI GAWTC 2 cut(s) 100, 470
PmaCI CACGTG 1 cut(s) 372
PmlI CACGTG 1 cut(s) 372
Ppu21I YACGTR 2 cut(s) 372, 658
Psp6I CCWGG 3 cut(s) 21, 80, 593
PspCI CACGTG 1 cut(s) 372
PspGI CCWGG 3 cut(s) 21, 80, 593
PspN4I GGNNCC 2 cut(s) 305, 546
PspPI GGNCC 1 cut(s) 544
PsrI GAACNNNNNNTAC 2 cut(s) 156, 188
PsuI RGATCY 2 cut(s) 143, 303
RsaI GTAC 3 cut(s) 221, 262, 466
RsaNI GTAC 3 cut(s) 220, 261, 465
RseI CAYNNNNRTG 2 cut(s) 108, 288
SaqAI TTAA 2 cut(s) 18, 614
Sau3AI GATC 8 cut(s) 143, 148, 226, 303, 452, 515, 559, 584
Sau96I GGNCC 1 cut(s) 544
ScrFI CCNGG 3 cut(s) 23, 82, 595
SduI GDGCHC 4 cut(s) 56, 80, 97, 324
SetI ASST 9 cut(s) 24, 108, 139, 190, 196, 341, 374, 448, 660
SfaNI GCATC 4 cut(s) 241, 412, 578, 580
SfcI CTRYAG 2 cut(s) 189, 195
SinI GGWCC 1 cut(s) 544
SmiMI CAYNNNNRTG 2 cut(s) 108, 288
Sse9I AATT 1 cut(s) 631
SsiI CCGC 1 cut(s) 301
SspMI CTAG 2 cut(s) 141, 161
StyD4I CCNGG 3 cut(s) 21, 80, 593
StyI CCWWGG 1 cut(s) 283
TaaI ACNGT 3 cut(s) 34, 265, 536
TaiI ACGT 2 cut(s) 374, 660
TaqI TCGA 1 cut(s) 451
TasI AATT 1 cut(s) 631
TatI WGTACW 2 cut(s) 219, 260
TfiI GAWTC 2 cut(s) 100, 470
Tru1I TTAA 2 cut(s) 18, 614
Tru9I TTAA 2 cut(s) 18, 614
TscAI CASTG 1 cut(s) 54
TseFI GTSAC 1 cut(s) 334
Tsp45I GTSAC 1 cut(s) 334
TspDTI ATGAA 2 cut(s) 52, 347
TspRI CASTG 1 cut(s) 54
VneI GTGCAC 1 cut(s) 76
VpaK11BI GGWCC 1 cut(s) 544
XapI RAATTY 1 cut(s) 631
XbaI TCTAGA 2 cut(s) 140, 160
XceI RCATGY 1 cut(s) 530
XcmI CCANNNNNNNNNTGG 1 cut(s) 538
XspI CTAG 2 cut(s) 141, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.