MD09G1025700.v1.1
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Reverse (-)
1555741 .. 1556323
583 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1025700.v1.1.491

Sequence Viewer

Length: 165 bp
ATGGGAAACTTGATTATCTACATCCCAGGTTCAGATGGAAGTACAACAAGCTATTGGTATGGCTACGTCACTCCTGATGATGTGCCAGAATTTGATCAGCATATTGGGAAGGGAGAGATTATAGAACGACTTTGGAGGTTTGGTCCAAATCGGAGCATCTTGTGA

Protein Analysis

55

Amino Acids

6.18

Weight (kDa)

4.65

Isoelectric Point (pI)

40.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Suc_Fer-like PF06999 2 - 46 2.1e-06 Sucrase/ferredoxin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 89
AfaI GTAC 1 cut(s) 43
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 1 cut(s) 51
AluI AGCT 1 cut(s) 51
ApoI RAATTY 1 cut(s) 89
AspS9I GGNCC 1 cut(s) 143
AvaII GGWCC 1 cut(s) 143
BccI CCATC 1 cut(s) 29
BciT130I CCWGG 1 cut(s) 27
BclI TGATCA 1 cut(s) 94
Bme1390I CCNGG 1 cut(s) 27
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 25
BsaXI ACNNNNNCTCC 2 cut(s) 127, 157
BseBI CCWGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 25
BseGI GGATG 1 cut(s) 21
Bsp143I GATC 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 25
BssMI GATC 1 cut(s) 94
Bst2UI CCWGG 1 cut(s) 27
BstF5I GGATG 1 cut(s) 21
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 1 cut(s) 25
BtsCI GGATG 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 143
Csp6I GTAC 1 cut(s) 42
CviJI RGCY 2 cut(s) 51, 63
CviKI_1 RGCY 2 cut(s) 51, 63
CviQI GTAC 1 cut(s) 42
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 25
FaiI YATR 3 cut(s) 60, 102, 122
FbaI TGATCA 1 cut(s) 94
FokI GGATG 1 cut(s) 8
Hpy188I TCNGA 2 cut(s) 34, 153
Hpy188III TCNNGA 1 cut(s) 74
HpyAV CCTTC 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 66
HpySE526I ACGT 1 cut(s) 66
Ksp22I TGATCA 1 cut(s) 94
Kzo9I GATC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 153
LpnPI CCDG 4 cut(s) 12, 39, 87, 99
MaeII ACGT 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MluCI AATT 1 cut(s) 89
MnlI CCTC 1 cut(s) 129
MspR9I CCNGG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 27
NdeII GATC 1 cut(s) 94
NmuCI GTSAC 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspPI GGNCC 1 cut(s) 143
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
Sau3AI GATC 1 cut(s) 94
Sau96I GGNCC 1 cut(s) 143
ScrFI CCNGG 1 cut(s) 27
SetI ASST 4 cut(s) 31, 53, 69, 140
SgeI CNNG 6 cut(s) 22, 38, 39, 60, 86, 98
SinI GGWCC 1 cut(s) 143
Sse9I AATT 1 cut(s) 89
StyD4I CCNGG 1 cut(s) 25
TaiI ACGT 1 cut(s) 69
TasI AATT 1 cut(s) 89
TatI WGTACW 1 cut(s) 41
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
VpaK11BI GGWCC 1 cut(s) 143
XapI RAATTY 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.