Rmu_sc0003981.1_g000001

Altered inheritance of mitochondria protein 32-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003981.1
Physical Location & Seq
Reverse (-)
399 .. 1267
869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003981.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
atgatcaaataccggggcttgaaagagtcagatgttgatagctttgtggatgatgttatcgtgaatgataaaccatgggcatctggagcacaggaggtcttgactggttctcacatttttgtgtgtgcccatggtagtcgagatcgtggatgtggtgtttgtggacctgttctcattgataaattcacaaaggaggctgaattgcgaggactgaaggatcaggtgtttgttagtccttgttctgacattgggggccacaagtatgctgggaacttgattatctacagccctggtgccgatggaaagatcactggccactggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.55

Weight (kDa)

6.03

Isoelectric Point (pI)

14.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 293
AclWI GGATC 1 cut(s) 225
AcoI YGGCCR 1 cut(s) 313
AcsI RAATTY 1 cut(s) 182
AcuI CTGAAG 1 cut(s) 233
AgsI TTSAA 1 cut(s) 22
AjnI CCWGG 1 cut(s) 289
AluBI AGCT 1 cut(s) 42
AluI AGCT 1 cut(s) 42
Alw21I GWGCWC 1 cut(s) 91
AlwI GGATC 1 cut(s) 225
AoxI GGCC 2 cut(s) 253, 313
ApoI RAATTY 1 cut(s) 182
AspS9I GGNCC 2 cut(s) 164, 253
AsuC2I CCSGG 1 cut(s) 14
AvaII GGWCC 1 cut(s) 164
BaeGI GKGCMC 1 cut(s) 130
BalI TGGCCA 1 cut(s) 315
BanI GGYRCC 1 cut(s) 293
Bbv12I GWGCWC 1 cut(s) 91
BccI CCATC 1 cut(s) 293
BciT130I CCWGG 1 cut(s) 291
BclI TGATCA 1 cut(s) 3
BcnI CCSGG 1 cut(s) 14
BfmI CTRYAG 1 cut(s) 283
Bme1390I CCNGG 2 cut(s) 14, 291
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 2 cut(s) 164, 253
BmiI GGNNCC 2 cut(s) 254, 295
BmrFI CCNGG 2 cut(s) 14, 291
BmsI GCATC 1 cut(s) 89
BpmI CTGGAG 1 cut(s) 105
BpuMI CCSGG 1 cut(s) 14
BsaJI CCNNGG 4 cut(s) 13, 74, 130, 289
Bse1I ACTGG 3 cut(s) 109, 316, 323
BseBI CCWGG 1 cut(s) 291
BseDI CCNNGG 4 cut(s) 13, 74, 130, 289
BseGI GGATG 2 cut(s) 55, 155
BseNI ACTGG 3 cut(s) 109, 316, 323
BseSI GKGCMC 1 cut(s) 130
BseYI CCCAGC 1 cut(s) 266
BshFI GGCC 2 cut(s) 255, 315
BshNI GGYRCC 1 cut(s) 293
BsiHKAI GWGCWC 1 cut(s) 91
BsiSI CCGG 1 cut(s) 13
BsnI GGCC 2 cut(s) 255, 315
Bsp1286I GDGCHC 2 cut(s) 91, 130
Bsp143I GATC 4 cut(s) 3, 142, 217, 306
Bsp19I CCATGG 2 cut(s) 74, 130
BspANI GGCC 2 cut(s) 255, 315
BspLI GGNNCC 2 cut(s) 254, 295
BspPI GGATC 1 cut(s) 225
BspT107I GGYRCC 1 cut(s) 293
BsrI ACTGG 3 cut(s) 109, 316, 323
BssECI CCNNGG 4 cut(s) 13, 74, 130, 289
BssMI GATC 4 cut(s) 3, 142, 217, 306
BssT1I CCWWGG 2 cut(s) 74, 130
Bst2UI CCWGG 1 cut(s) 291
BstDSI CCRYGG 2 cut(s) 74, 130
BstF5I GGATG 2 cut(s) 55, 155
BstKTI GATC 4 cut(s) 6, 145, 220, 309
BstMBI GATC 4 cut(s) 3, 142, 217, 306
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 291
BstSCI CCNGG 2 cut(s) 12, 289
BstSFI CTRYAG 1 cut(s) 283
BstSLI GKGCMC 1 cut(s) 130
BsuRI GGCC 2 cut(s) 255, 315
BtgI CCRYGG 2 cut(s) 74, 130
BtsCI GGATG 2 cut(s) 55, 155
BtsIMutI CAGTG 2 cut(s) 309, 316
Cfr13I GGNCC 2 cut(s) 164, 253
CviAII CATG 2 cut(s) 75, 131
CviJI RGCY 6 cut(s) 18, 42, 197, 255, 288, 315
CviKI_1 RGCY 6 cut(s) 18, 42, 197, 255, 288, 315
DpnI GATC 4 cut(s) 5, 144, 219, 308
DpnII GATC 4 cut(s) 3, 142, 217, 306
EaeI YGGCCR 1 cut(s) 313
Eco130I CCWWGG 2 cut(s) 74, 130
Eco47I GGWCC 1 cut(s) 164
Eco57I CTGAAG 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 289
EcoT14I CCWWGG 2 cut(s) 74, 130
ErhI CCWWGG 2 cut(s) 74, 130
FaeI CATG 2 cut(s) 78, 134
FaiI YATR 3 cut(s) 76, 132, 264
FatI CATG 2 cut(s) 74, 130
FbaI TGATCA 1 cut(s) 3
FokI GGATG 2 cut(s) 62, 162
GsaI CCCAGC 1 cut(s) 270
GsuI CTGGAG 1 cut(s) 105
HaeIII GGCC 2 cut(s) 255, 315
HapII CCGG 1 cut(s) 13
Hin1II CATG 2 cut(s) 78, 134
HinfI GANTC 1 cut(s) 26
HpaII CCGG 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 164
Hpy188I TCNGA 2 cut(s) 31, 244
Hpy188III TCNNGA 4 cut(s) 61, 84, 100, 140
Hpy8I GTNNAC 1 cut(s) 164
HpyAV CCTTC 1 cut(s) 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
Hsp92II CATG 2 cut(s) 78, 134
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 4 cut(s) 3, 142, 217, 306
LmnI GCTCC 1 cut(s) 86
LweI GCATC 1 cut(s) 89
MalI GATC 4 cut(s) 5, 144, 219, 308
MboI GATC 4 cut(s) 3, 142, 217, 306
MhlI GDGCHC 2 cut(s) 91, 130
MlsI TGGCCA 1 cut(s) 315
MluCI AATT 2 cut(s) 182, 200
MluNI TGGCCA 1 cut(s) 315
MlyI GAGTC 1 cut(s) 35
MnlI CCTC 3 cut(s) 88, 187, 200
Mox20I TGGCCA 1 cut(s) 315
MscI TGGCCA 1 cut(s) 315
MslI CAYNNNNRTG 2 cut(s) 119, 261
Msp20I TGGCCA 1 cut(s) 315
MspI CCGG 1 cut(s) 13
MspR9I CCNGG 2 cut(s) 14, 291
MvaI CCWGG 1 cut(s) 291
MwoI GCNNNNNNNGC 1 cut(s) 86
NciI CCSGG 1 cut(s) 14
NcoI CCATGG 2 cut(s) 74, 130
NdeII GATC 4 cut(s) 3, 142, 217, 306
NlaIII CATG 2 cut(s) 78, 134
NlaIV GGNNCC 2 cut(s) 254, 295
PleI GAGTC 1 cut(s) 34
PpsI GAGTC 1 cut(s) 34
Psp6I CCWGG 1 cut(s) 289
PspFI CCCAGC 1 cut(s) 266
PspGI CCWGG 1 cut(s) 289
PspN4I GGNNCC 2 cut(s) 254, 295
PspPI GGNCC 2 cut(s) 164, 253
RseI CAYNNNNRTG 2 cut(s) 119, 261
Sau3AI GATC 4 cut(s) 3, 142, 217, 306
Sau96I GGNCC 2 cut(s) 164, 253
SchI GAGTC 1 cut(s) 35
ScrFI CCNGG 2 cut(s) 14, 291
SduI GDGCHC 2 cut(s) 91, 130
SetI ASST 4 cut(s) 44, 99, 169, 225
SfaNI GCATC 1 cut(s) 89
SfcI CTRYAG 1 cut(s) 283
SinI GGWCC 1 cut(s) 164
SmiMI CAYNNNNRTG 2 cut(s) 119, 261
Sse9I AATT 2 cut(s) 182, 200
StyD4I CCNGG 2 cut(s) 12, 289
StyI CCWWGG 2 cut(s) 74, 130
TaqI TCGA 1 cut(s) 139
TasI AATT 2 cut(s) 182, 200
TscAI CASTG 2 cut(s) 316, 323
TspRI CASTG 2 cut(s) 316, 323
VpaK11BI GGWCC 1 cut(s) 164
XapI RAATTY 1 cut(s) 182
XcmI CCANNNNNNNNNTGG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.