pycom16g12860

Cell wall vacuolar inhibitor of fructosidase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
9088356 .. 9088709
354 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 354 bp
ATGAAATTGAAACAGGAGTATAAGTTAACTGCCAACAGAATCAGAACAAACAATCCCAACAAAGTTTCCATTTTTCTGTTCCCATCTTGGAAGATGAGTAGCTCAATCTCAAGATTCTCAACCCTTCTTCCTTTTCTACTCGTTGTTTTACTCTTTGCACCCCCAACAACCCAATCGTTTTTTATTCCATCAGATGAAGGCAATGATCGATCTTGTGCGTTGATACAAACAACATGCAAAAAAACACCCCACTATCGATCTCTGCCTCTCAACCCTCCAATCAAACCCCGACAGCTCAAACGCCGACGTGCCGGGATTGGCCCGGATAGTATCCGATGCTCTACTGGCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.31

Weight (kDa)

10.82

Isoelectric Point (pI)

61.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 10
AjiI CACGTC 1 cut(s) 308
AloI GAACNNNNNNTCC 2 cut(s) 37, 69
AluBI AGCT 2 cut(s) 102, 295
AluI AGCT 2 cut(s) 102, 295
AoxI GGCC 1 cut(s) 319
AspS9I GGNCC 1 cut(s) 320
AsuC2I CCSGG 2 cut(s) 313, 323
BccI CCATC 2 cut(s) 91, 196
BciVI GTATCC 1 cut(s) 341
BcnI CCSGG 2 cut(s) 313, 323
BfuI GTATCC 1 cut(s) 341
Bme1390I CCNGG 2 cut(s) 313, 323
BmgBI CACGTC 1 cut(s) 308
BmgT120I GGNCC 1 cut(s) 320
BmrFI CCNGG 2 cut(s) 313, 323
BmsI GCATC 1 cut(s) 326
BpuEI CTTGAG 1 cut(s) 94
BpuMI CCSGG 2 cut(s) 313, 323
Bsa29I ATCGAT 2 cut(s) 208, 256
BsaXI ACNNNNNCTCC 2 cut(s) 8, 38
Bse1I ACTGG 1 cut(s) 349
Bse3DI GCAATG 1 cut(s) 208
BseCI ATCGAT 2 cut(s) 208, 256
BseMI GCAATG 1 cut(s) 208
BseNI ACTGG 1 cut(s) 349
BshFI GGCC 1 cut(s) 321
BshVI ATCGAT 2 cut(s) 208, 256
BsiSI CCGG 2 cut(s) 312, 323
BsnI GGCC 1 cut(s) 321
Bsp143I GATC 3 cut(s) 205, 209, 257
BspANI GGCC 1 cut(s) 321
BspDI ATCGAT 2 cut(s) 208, 256
BsrDI GCAATG 1 cut(s) 208
BsrI ACTGG 1 cut(s) 349
BssMI GATC 3 cut(s) 205, 209, 257
BstKTI GATC 3 cut(s) 208, 212, 260
BstMBI GATC 3 cut(s) 205, 209, 257
BstMWI GCNNNNNNNGC 1 cut(s) 345
BstNSI RCATGY 1 cut(s) 237
BstSCI CCNGG 2 cut(s) 311, 321
Bsu15I ATCGAT 2 cut(s) 208, 256
BsuI GTATCC 1 cut(s) 341
BsuRI GGCC 1 cut(s) 321
BsuTUI ATCGAT 2 cut(s) 208, 256
BtrI CACGTC 1 cut(s) 308
Cfr13I GGNCC 1 cut(s) 320
ClaI ATCGAT 2 cut(s) 208, 256
CviAII CATG 1 cut(s) 234
CviJI RGCY 3 cut(s) 102, 295, 321
CviKI_1 RGCY 3 cut(s) 102, 295, 321
DpnI GATC 3 cut(s) 207, 211, 259
DpnII GATC 3 cut(s) 205, 209, 257
FaeI CATG 1 cut(s) 237
FaiI YATR 2 cut(s) 21, 235
FatI CATG 1 cut(s) 233
HaeIII GGCC 1 cut(s) 321
HapII CCGG 2 cut(s) 312, 323
Hin1II CATG 1 cut(s) 237
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
HinfI GANTC 2 cut(s) 39, 114
HpaI GTTAAC 1 cut(s) 27
HpaII CCGG 2 cut(s) 312, 323
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 3 cut(s) 44, 193, 335
Hpy188III TCNNGA 1 cut(s) 111
Hpy8I GTNNAC 1 cut(s) 27
Hpy99I CGWCG 1 cut(s) 309
HpyAV CCTTC 2 cut(s) 134, 191
HpyCH4IV ACGT 1 cut(s) 307
HpyCH4V TGCA 2 cut(s) 158, 237
HpyF10VI GCNNNNNNNGC 1 cut(s) 345
HpySE526I ACGT 1 cut(s) 307
Hsp92II CATG 1 cut(s) 237
KspAI GTTAAC 1 cut(s) 27
Kzo9I GATC 3 cut(s) 205, 209, 257
LpnPI CCDG 3 cut(s) 325, 330, 336
LweI GCATC 1 cut(s) 326
MaeII ACGT 1 cut(s) 307
MalI GATC 3 cut(s) 207, 211, 259
MboI GATC 3 cut(s) 205, 209, 257
MboII GAAGA 2 cut(s) 103, 119
MluCI AATT 1 cut(s) 5
MnlI CCTC 2 cut(s) 276, 285
MseI TTAA 1 cut(s) 26
MspI CCGG 2 cut(s) 312, 323
MspR9I CCNGG 2 cut(s) 313, 323
MwoI GCNNNNNNNGC 1 cut(s) 345
NciI CCSGG 2 cut(s) 313, 323
NdeII GATC 3 cut(s) 205, 209, 257
NlaIII CATG 1 cut(s) 237
NspI RCATGY 1 cut(s) 237
PfeI GAWTC 2 cut(s) 39, 114
PspPI GGNCC 1 cut(s) 320
SaqAI TTAA 1 cut(s) 26
Sau3AI GATC 3 cut(s) 205, 209, 257
Sau96I GGNCC 1 cut(s) 320
ScrFI CCNGG 2 cut(s) 313, 323
SetI ASST 3 cut(s) 104, 297, 310
SfaNI GCATC 1 cut(s) 326
SmlI CTYRAG 1 cut(s) 109
SmoI CTYRAG 1 cut(s) 109
Sse9I AATT 1 cut(s) 5
StyD4I CCNGG 2 cut(s) 311, 321
TaiI ACGT 1 cut(s) 310
TaqI TCGA 2 cut(s) 208, 256
TasI AATT 1 cut(s) 5
TfiI GAWTC 2 cut(s) 39, 114
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TspDTI ATGAA 2 cut(s) 17, 210
XceI RCATGY 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.