Rmu_sc0003475.1_g000029

Cell wall vacuolar inhibitor of fructosidase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003475.1
OG0000921
Physical Location & Seq
Forward (+)
134488 .. 137417
2930 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003475.1_g000029.1.cds

Sequence Viewer

Length: 1170 bp
ctggtctgcagcgatggatgttttgcagggaggctgaggcccgtgtgggctaatgaggacggggaacgagtgagctgctatgtcgtcgtcaatgtgggtgctgcgacagtggggagcggacgattccgatctaggtgctacgacggtggactgatgcgagctggtgtccggatcgatctggaaaggcagcaggcgctggtgtctggtcgcggcggggctgcagggagggtgctgcgctgctgggctggggttgctcggccggtgaaggatgctgggttgctcgggtgtggcagcttgcaaacggcaacgctgaaggaagggggggccgatctgggcaagatttcggcagtgctcatatttttcattcaaactgcaattttacgaaccgaagcaaatatcattgcccaaacatgtcaaaaaacaccaaaccctccggtgtgtctctcgtctctcaaatccgaccctcggagcgcccaagcagacatatatggcttggctatcataatggtcgatgtggtcaaggcaaagtccacgacgactctgaaccaaatcaaccaattgcttaagcaaagcccgagagacaaaggcttaatagattgtgctgacaggtacaacgcagttttaaaaggtgatgtcccagaagcctatgaggcaatcaatgtaagaagacgtatgtttgcattggatggcatgaatgacgctgtgaatgaggctaatggatgcgaaagaaactttgcaggcagaagctctcatcctctgactaaattgaataaagatgtggcagatgttgctagtgtggctgcagcagaagtgcatttgatcgtccagcaagagtggctgcccggtccgacggctcgccctcgcggtggcgtcgtcggacagactagaaaggacaatgtgtccggtggtgtttggcccggtctgagagaaggttgcgggagcgcgatgttgctgtccagagcgcttggaggaattaacggtgatgggcagcgacgggttaatggctggaagttggggtcggtgtcgtcttgccttagggaggaacgtgtaaggcatggtaggtgttttgaggaggtgttgcaggattggagattgcctgagggtggtgaccgggcggtggcatcgctgcaaatcactgggcttagatcggatcggttagacccgatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

389

Amino Acids

41.66

Weight (kDa)

9.15

Isoelectric Point (pI)

38.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 117
AccII CGCG 3 cut(s) 210, 864, 944
AccIII TCCGGA 1 cut(s) 168
AciI CCGC 6 cut(s) 117, 210, 213, 864, 936, 1115
AclWI GGATC 2 cut(s) 179, 1158
AcoI YGGCCR 1 cut(s) 257
AcuI CTGAAG 1 cut(s) 332
AcyI GRCGYC 1 cut(s) 870
AfaI GTAC 1 cut(s) 611
AfeI AGCGCT 1 cut(s) 963
AfiI CCNNNNNNNGG 5 cut(s) 465, 866, 1039, 1103, 1117
AflII CTTAAG 1 cut(s) 563
AflIII ACRYGT 2 cut(s) 410, 1045
AgsI TTSAA 2 cut(s) 368, 769
AhdI GACNNNNNGTC 1 cut(s) 898
AluBI AGCT 4 cut(s) 75, 161, 294, 747
AluI AGCT 4 cut(s) 75, 161, 294, 747
Alw21I GWGCWC 1 cut(s) 354
Alw26I GTCTC 3 cut(s) 446, 453, 573
AlwI GGATC 2 cut(s) 179, 1158
AlwNI CAGNNNCTG 1 cut(s) 196
Ama87I CYCGRG 2 cut(s) 281, 574
Aor13HI TCCGGA 1 cut(s) 168
Aor51HI AGCGCT 1 cut(s) 963
AoxI GGCC 4 cut(s) 38, 257, 324, 914
AspLEI GCGC 5 cut(s) 196, 237, 473, 944, 964
AspS9I GGNCC 4 cut(s) 39, 324, 845, 915
AsuC2I CCSGG 3 cut(s) 843, 918, 1112
AsuHPI GGTGA 4 cut(s) 274, 641, 992, 1118
AvaI CYCGRG 2 cut(s) 281, 574
AvaII GGWCC 1 cut(s) 845
AxyI CCTNAGG 2 cut(s) 1034, 1098
BbsI GAAGAC 1 cut(s) 673
Bbv12I GWGCWC 1 cut(s) 354
BbvCI CCTCAGC 1 cut(s) 35
BccI CCATC 3 cut(s) 8, 680, 977
BceAI ACGGC 2 cut(s) 318, 867
BcgI CGANNNNNNTGC 4 cut(s) 57, 91, 117, 151
BcnI CCSGG 3 cut(s) 843, 918, 1112
BcoDI GTCTC 3 cut(s) 446, 453, 573
BfaI CTAG 3 cut(s) 132, 792, 885
BfmI CTRYAG 3 cut(s) 7, 219, 801
BfoI RGCGCY 3 cut(s) 197, 474, 965
BfrI CTTAAG 1 cut(s) 563
BglI GCCNNNNNGGC 1 cut(s) 650
Bme1390I CCNGG 3 cut(s) 843, 918, 1112
Bme18I GGWCC 1 cut(s) 845
BmeRI GACNNNNNGTC 1 cut(s) 898
BmeT110I CYCGRG 2 cut(s) 281, 574
BmgT120I GGNCC 4 cut(s) 39, 324, 845, 915
BmiI GGNNCC 1 cut(s) 325
BmrFI CCNGG 3 cut(s) 843, 918, 1112
BmrI ACTGGG 1 cut(s) 1146
BmsI GCATC 4 cut(s) 144, 259, 710, 1130
BmuI ACTGGG 1 cut(s) 1146
BpiI GAAGAC 1 cut(s) 673
Bpu10I CCTNAGC 1 cut(s) 35
BpuMI CCSGG 3 cut(s) 843, 918, 1112
Bsa29I ATCGAT 1 cut(s) 174
BsaBI GATNNNNATC 1 cut(s) 127
BsaHI GRCGYC 1 cut(s) 870
BsaJI CCNNGG 1 cut(s) 464
BsaWI WCCGGW 3 cut(s) 168, 433, 902
Bsc4I CCNNNNNNNGG 5 cut(s) 465, 866, 1039, 1103, 1117
Bse118I RCCGGY 1 cut(s) 259
Bse1I ACTGG 1 cut(s) 1141
Bse21I CCTNAGG 2 cut(s) 1034, 1098
Bse3DI GCAATG 1 cut(s) 399
Bse8I GATNNNNATC 1 cut(s) 127
BseAI TCCGGA 1 cut(s) 168
BseCI ATCGAT 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 464
BseGI GGATG 5 cut(s) 23, 274, 691, 725, 751
BseJI GATNNNNATC 1 cut(s) 127
BseLI CCNNNNNNNGG 5 cut(s) 465, 866, 1039, 1103, 1117
BseMI GCAATG 1 cut(s) 399
BseMII CTCAG 3 cut(s) 26, 914, 1089
BseNI ACTGG 1 cut(s) 1141
BseRI GAGGAG 1 cut(s) 1085
BseX3I CGGCCG 1 cut(s) 257
BseYI CCCAGC 3 cut(s) 240, 245, 272
Bsh1236I CGCG 3 cut(s) 210, 864, 944
Bsh1285I CGRYCG 1 cut(s) 260
BshFI GGCC 4 cut(s) 40, 259, 326, 916
BshVI ATCGAT 1 cut(s) 174
BsiEI CGRYCG 1 cut(s) 260
BsiHKAI GWGCWC 1 cut(s) 354
BsiHKCI CYCGRG 2 cut(s) 281, 574
BsiSI CCGG 7 cut(s) 169, 260, 434, 843, 903, 918, 1111
BslFI GGGAC 1 cut(s) 620
BslI CCNNNNNNNGG 5 cut(s) 465, 866, 1039, 1103, 1117
BsmAI GTCTC 3 cut(s) 446, 453, 573
BsmBI CGTCTC 1 cut(s) 453
BsmFI GGGAC 1 cut(s) 620
BsnI GGCC 4 cut(s) 40, 259, 326, 916
BsoBI CYCGRG 2 cut(s) 281, 574
Bsp1286I GDGCHC 1 cut(s) 354
Bsp13I TCCGGA 1 cut(s) 168
Bsp143I GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
BspACI CCGC 6 cut(s) 117, 210, 213, 864, 936, 1115
BspANI GGCC 4 cut(s) 40, 259, 326, 916
BspCNI CTCAG 3 cut(s) 27, 915, 1090
BspDI ATCGAT 1 cut(s) 174
BspEI TCCGGA 1 cut(s) 168
BspFNI CGCG 3 cut(s) 210, 864, 944
BspLI GGNNCC 1 cut(s) 325
BspMAI CTGCAG 3 cut(s) 11, 223, 805
BspPI GGATC 2 cut(s) 179, 1158
BspTI CTTAAG 1 cut(s) 563
BsrBI CCGCTC 1 cut(s) 117
BsrDI GCAATG 1 cut(s) 399
BsrFI RCCGGY 1 cut(s) 259
BsrI ACTGG 1 cut(s) 1141
BssAI RCCGGY 1 cut(s) 259
BssECI CCNNGG 1 cut(s) 464
BssMI GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
BssNI GRCGYC 1 cut(s) 870
Bst4CI ACNGT 3 cut(s) 109, 146, 980
BstACI GRCGYC 1 cut(s) 870
BstAFI CTTAAG 1 cut(s) 563
BstAPI GCANNNNNTGC 1 cut(s) 788
BstC8I GCNNGC 5 cut(s) 159, 192, 296, 739, 856
BstDEI CTNAG 5 cut(s) 35, 923, 1034, 1098, 1142
BstEII GGTNACC 1 cut(s) 1106
BstENI CCTNNNNNAGG 1 cut(s) 1037
BstF5I GGATG 5 cut(s) 23, 274, 691, 725, 751
BstFNI CGCG 3 cut(s) 210, 864, 944
BstH2I RGCGCY 3 cut(s) 197, 474, 965
BstHHI GCGC 5 cut(s) 196, 237, 473, 944, 964
BstKTI GATC 8 cut(s) 131, 174, 178, 331, 822, 1148, 1153, 1167
BstMAI GTCTC 3 cut(s) 446, 453, 573
BstMBI GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
BstMCI CGRYCG 1 cut(s) 260
BstMWI GCNNNNNNNGC 6 cut(s) 193, 251, 650, 788, 797, 835
BstNSI RCATGY 1 cut(s) 414
BstPI GGTNACC 1 cut(s) 1106
BstSCI CCNGG 3 cut(s) 841, 916, 1110
BstSFI CTRYAG 3 cut(s) 7, 219, 801
BstUI CGCG 3 cut(s) 210, 864, 944
BstV2I GAAGAC 1 cut(s) 673
BstZI CGGCCG 1 cut(s) 257
Bsu15I ATCGAT 1 cut(s) 174
Bsu36I CCTNAGG 2 cut(s) 1034, 1098
BsuRI GGCC 4 cut(s) 40, 259, 326, 916
BsuTUI ATCGAT 1 cut(s) 174
BtgZI GCGATG 3 cut(s) 27, 959, 1107
BtsCI GGATG 5 cut(s) 23, 274, 691, 725, 751
BtsI GCAGTG 1 cut(s) 354
BtsIMutI CAGTG 3 cut(s) 114, 354, 1134
Cac8I GCNNGC 5 cut(s) 159, 192, 296, 739, 856
CaiI CAGNNNCTG 1 cut(s) 196
CfoI GCGC 5 cut(s) 196, 237, 473, 944, 964
Cfr10I RCCGGY 1 cut(s) 259
Cfr13I GGNCC 4 cut(s) 39, 324, 845, 915
ClaI ATCGAT 1 cut(s) 174
CpoI CGGWCCG 1 cut(s) 845
CseI GACGC 2 cut(s) 707, 859
Csp6I GTAC 1 cut(s) 610
CspI CGGWCCG 1 cut(s) 845
CviAII CATG 3 cut(s) 411, 691, 1055
CviQI GTAC 1 cut(s) 610
DdeI CTNAG 5 cut(s) 35, 923, 1034, 1098, 1142
DpnI GATC 8 cut(s) 130, 173, 177, 330, 821, 1147, 1152, 1166
DpnII GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
DraI TTTAAA 1 cut(s) 624
DriI GACNNNNNGTC 1 cut(s) 898
EaeI YGGCCR 1 cut(s) 257
EagI CGGCCG 1 cut(s) 257
Eam1105I GACNNNNNGTC 1 cut(s) 898
EclXI CGGCCG 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 845
Eco47III AGCGCT 1 cut(s) 963
Eco52I CGGCCG 1 cut(s) 257
Eco57I CTGAAG 1 cut(s) 332
Eco81I CCTNAGG 2 cut(s) 1034, 1098
Eco88I CYCGRG 2 cut(s) 281, 574
Eco91I GGTNACC 1 cut(s) 1106
EcoNI CCTNNNNNAGG 1 cut(s) 1037
EcoO65I GGTNACC 1 cut(s) 1106
Esp3I CGTCTC 1 cut(s) 453
FaeI CATG 3 cut(s) 414, 694, 1058
FaqI GGGAC 1 cut(s) 620
FatI CATG 3 cut(s) 410, 690, 1054
FauI CCCGC 2 cut(s) 206, 929
FokI GGATG 5 cut(s) 30, 281, 698, 732, 738
FspBI CTAG 3 cut(s) 132, 792, 885
GlaI GCGC 5 cut(s) 195, 236, 472, 943, 963
GsaI CCCAGC 3 cut(s) 244, 249, 276
HaeII RGCGCY 3 cut(s) 197, 474, 965
HaeIII GGCC 4 cut(s) 40, 259, 326, 916
HapII CCGG 7 cut(s) 169, 260, 434, 843, 903, 918, 1111
HgaI GACGC 2 cut(s) 707, 859
HhaI GCGC 5 cut(s) 196, 237, 473, 944, 964
Hin1I GRCGYC 1 cut(s) 870
Hin1II CATG 3 cut(s) 414, 694, 1058
Hin6I GCGC 5 cut(s) 194, 235, 471, 942, 962
HinP1I GCGC 5 cut(s) 194, 235, 471, 942, 962
HinfI GANTC 2 cut(s) 123, 538
HpaII CCGG 7 cut(s) 169, 260, 434, 843, 903, 918, 1111
HphI GGTGA 4 cut(s) 274, 641, 992, 1118
Hpy166II GTNNAC 2 cut(s) 149, 531
Hpy188III TCNNGA 3 cut(s) 169, 179, 957
Hpy8I GTNNAC 2 cut(s) 149, 531
Hpy99I CGWCG 7 cut(s) 89, 146, 538, 853, 875, 878, 996
HpyAV CCTTC 4 cut(s) 259, 307, 311, 923
HpyCH4III ACNGT 3 cut(s) 109, 146, 980
HpyCH4IV ACGT 2 cut(s) 670, 1045
HpyF10VI GCNNNNNNNGC 6 cut(s) 193, 251, 650, 788, 797, 835
HpyF3I CTNAG 5 cut(s) 35, 923, 1034, 1098, 1142
HpySE526I ACGT 2 cut(s) 670, 1045
Hsp92I GRCGYC 1 cut(s) 870
Hsp92II CATG 3 cut(s) 414, 694, 1058
HspAI GCGC 5 cut(s) 194, 235, 471, 942, 962
Kpn2I TCCGGA 1 cut(s) 168
Kzo9I GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
LmnI GCTCC 3 cut(s) 114, 468, 939
LweI GCATC 4 cut(s) 144, 259, 710, 1130
MaeI CTAG 3 cut(s) 132, 792, 885
MaeII ACGT 2 cut(s) 670, 1045
MaeIII GTNAC 1 cut(s) 1106
MalI GATC 8 cut(s) 130, 173, 177, 330, 821, 1147, 1152, 1166
MbiI CCGCTC 1 cut(s) 117
MboI GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
MboII GAAGA 1 cut(s) 678
MfeI CAATTG 1 cut(s) 557
MhlI GDGCHC 1 cut(s) 354
MluCI AATT 4 cut(s) 375, 557, 764, 972
MlyI GAGTC 1 cut(s) 532
MmeI TCCRAC 3 cut(s) 483, 856, 872
MroI TCCGGA 1 cut(s) 168
MseI TTAA 5 cut(s) 564, 590, 623, 975, 999
MspCI CTTAAG 1 cut(s) 563
MspI CCGG 7 cut(s) 169, 260, 434, 843, 903, 918, 1111
MspR9I CCNGG 3 cut(s) 843, 918, 1112
MunI CAATTG 1 cut(s) 557
MvnI CGCG 3 cut(s) 210, 864, 944
MwoI GCNNNNNNNGC 6 cut(s) 193, 251, 650, 788, 797, 835
NciI CCSGG 3 cut(s) 843, 918, 1112
NdeII GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
NlaIII CATG 3 cut(s) 414, 694, 1058
NlaIV GGNNCC 1 cut(s) 325
NmeAIII GCCGAG 1 cut(s) 235
NmuCI GTSAC 1 cut(s) 1106
NspI RCATGY 1 cut(s) 414
PciI ACATGT 1 cut(s) 410
PfeI GAWTC 1 cut(s) 123
PleI GAGTC 1 cut(s) 532
PpsI GAGTC 1 cut(s) 532
PscI ACATGT 1 cut(s) 410
PspEI GGTNACC 1 cut(s) 1106
PspFI CCCAGC 3 cut(s) 240, 245, 272
PspN4I GGNNCC 1 cut(s) 325
PspPI GGNCC 4 cut(s) 39, 324, 845, 915
PstI CTGCAG 3 cut(s) 11, 223, 805
PstNI CAGNNNCTG 1 cut(s) 196
RsaI GTAC 1 cut(s) 611
RsaNI GTAC 1 cut(s) 610
Rsr2I CGGWCCG 1 cut(s) 845
RsrII CGGWCCG 1 cut(s) 845
SaqAI TTAA 5 cut(s) 564, 590, 623, 975, 999
Sau3AI GATC 8 cut(s) 128, 171, 175, 328, 819, 1145, 1150, 1164
Sau96I GGNCC 4 cut(s) 39, 324, 845, 915
SchI GAGTC 1 cut(s) 532
ScrFI CCNGG 3 cut(s) 843, 918, 1112
SduI GDGCHC 1 cut(s) 354
SfaNI GCATC 4 cut(s) 144, 259, 710, 1130
SfcI CTRYAG 3 cut(s) 7, 219, 801
SinI GGWCC 1 cut(s) 845
SmlI CTYRAG 1 cut(s) 563
SmoI CTYRAG 1 cut(s) 563
Sse9I AATT 4 cut(s) 375, 557, 764, 972
SsiI CCGC 6 cut(s) 117, 210, 213, 864, 936, 1115
SspMI CTAG 3 cut(s) 132, 792, 885
StyD4I CCNGG 3 cut(s) 841, 916, 1110
TaaI ACNGT 3 cut(s) 109, 146, 980
TaiI ACGT 2 cut(s) 673, 1048
TaqI TCGA 2 cut(s) 174, 510
TasI AATT 4 cut(s) 375, 557, 764, 972
TauI GCSGC 1 cut(s) 213
TfiI GAWTC 1 cut(s) 123
Tru1I TTAA 5 cut(s) 564, 590, 623, 975, 999
Tru9I TTAA 5 cut(s) 564, 590, 623, 975, 999
TscAI CASTG 3 cut(s) 114, 354, 1141
TseFI GTSAC 1 cut(s) 1106
Tsp45I GTSAC 1 cut(s) 1106
TspDTI ATGAA 2 cut(s) 352, 707
TspRI CASTG 3 cut(s) 114, 354, 1141
Vha464I CTTAAG 1 cut(s) 563
VpaK11BI GGWCC 1 cut(s) 845
XagI CCTNNNNNAGG 1 cut(s) 1037
XceI RCATGY 1 cut(s) 414
XspI CTAG 3 cut(s) 132, 792, 885
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.