RchiOBHm_Chr3g0496271

Belongs to the isocitrate and isopropylmalate dehydrogenases family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
46991928 .. 46992331
404 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 153 bp
ATGAATACTGCCTACCAGAAAAAGTGGCCACTTTATCTTAGCACTAAAAATACTATTCTCAAGAAATATGATGGAAGGAAATTTATGAAACTCATTGGAGATCCAGATTTGAAGCCTCATCGAAATATCCCTCCCCGACGGATATTATGTTAG

Protein Analysis

50

Amino Acids

6.0

Weight (kDa)

10.24

Isoelectric Point (pI)

35.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 95
AcoI YGGCCR 1 cut(s) 26
AcsI RAATTY 1 cut(s) 80
AgsI TTSAA 1 cut(s) 112
AlwI GGATC 1 cut(s) 95
AoxI GGCC 1 cut(s) 26
ApoI RAATTY 1 cut(s) 80
BalI TGGCCA 1 cut(s) 28
BccI CCATC 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 44
BshFI GGCC 1 cut(s) 28
BsnI GGCC 1 cut(s) 28
Bsp143I GATC 1 cut(s) 100
BspANI GGCC 1 cut(s) 28
BspPI GGATC 1 cut(s) 95
BssMI GATC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 38
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 28
CviJI RGCY 2 cut(s) 28, 115
CviKI_1 RGCY 2 cut(s) 28, 115
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
EaeI YGGCCR 1 cut(s) 26
FaiI YATR 3 cut(s) 69, 86, 148
HaeIII GGCC 1 cut(s) 28
Hpy188III TCNNGA 2 cut(s) 61, 104
Hpy99I CGWCG 1 cut(s) 141
HpyAV CCTTC 1 cut(s) 69
HpyF3I CTNAG 1 cut(s) 38
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 2 cut(s) 29, 117
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MflI RGATCY 1 cut(s) 100
MlsI TGGCCA 1 cut(s) 28
MluCI AATT 1 cut(s) 80
MluNI TGGCCA 1 cut(s) 28
MnlI CCTC 2 cut(s) 126, 141
Mox20I TGGCCA 1 cut(s) 28
MscI TGGCCA 1 cut(s) 28
Msp20I TGGCCA 1 cut(s) 28
NdeII GATC 1 cut(s) 100
PsuI RGATCY 1 cut(s) 100
Sau3AI GATC 1 cut(s) 100
SgeI CNNG 4 cut(s) 28, 73, 116, 147
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
Sse9I AATT 1 cut(s) 80
TaqI TCGA 1 cut(s) 121
TasI AATT 1 cut(s) 80
TspDTI ATGAA 2 cut(s) 17, 101
XapI RAATTY 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.