Rh1BG010100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
1195827 .. 1196030
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG010100.1

Sequence Viewer

Length: 204 bp
ATGAATCTACAGCAAATCATTTGGAACTCTTTCCGTGGATTTCTGACTGGATTTCAAAAAGAGGCACAAAGGAAACTCTTCTCAACTGAACAAGGCAAGTCGTGGGCTGCAAATTCAGCAGCTTTTGCACCTCCATGCCCATCAAATACACCAAAAAACACCTGCAAACATGAATCTAGAGCTTATCAAGTTCCAATTCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.57

Weight (kDa)

9.78

Isoelectric Point (pI)

36.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 170
Acc36I ACCTGC 1 cut(s) 170
AcsI RAATTY 1 cut(s) 112
AgsI TTSAA 1 cut(s) 56
AluBI AGCT 2 cut(s) 122, 182
AluI AGCT 2 cut(s) 122, 182
ApeKI GCWGC 2 cut(s) 107, 119
ApoI RAATTY 1 cut(s) 112
Asp700I GAANNNNTTC 2 cut(s) 29, 77
BbvI GCAGC 2 cut(s) 94, 131
BccI CCATC 1 cut(s) 148
BfaI CTAG 2 cut(s) 177, 202
BfmI CTRYAG 1 cut(s) 8
BfuAI ACCTGC 1 cut(s) 170
BisI GCNGC 2 cut(s) 108, 120
BlsI GCNGC 2 cut(s) 109, 121
BsaJI CCNNGG 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 52
BseDI CCNNGG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 52
BseXI GCAGC 2 cut(s) 94, 131
BspMI ACCTGC 1 cut(s) 170
BsrI ACTGG 1 cut(s) 52
BssECI CCNNGG 1 cut(s) 34
Bst6I CTCTTC 1 cut(s) 83
BstAPI GCANNNNNTGC 1 cut(s) 125
BstDSI CCRYGG 1 cut(s) 34
BstMWI GCNNNNNNNGC 2 cut(s) 116, 125
BstSFI CTRYAG 1 cut(s) 8
BstV1I GCAGC 2 cut(s) 94, 131
BtgI CCRYGG 1 cut(s) 34
BveI ACCTGC 1 cut(s) 170
CviAII CATG 2 cut(s) 135, 170
CviJI RGCY 3 cut(s) 107, 122, 182
CviKI_1 RGCY 3 cut(s) 107, 122, 182
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
FaeI CATG 2 cut(s) 138, 173
FaiI YATR 2 cut(s) 136, 171
FatI CATG 2 cut(s) 134, 169
Fnu4HI GCNGC 2 cut(s) 108, 120
Fsp4HI GCNGC 2 cut(s) 108, 120
FspBI CTAG 2 cut(s) 177, 202
GluI GCNGC 2 cut(s) 108, 120
Hin1II CATG 2 cut(s) 138, 173
HinfI GANTC 2 cut(s) 4, 173
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 177
HpyCH4V TGCA 3 cut(s) 110, 128, 165
HpyF10VI GCNNNNNNNGC 2 cut(s) 116, 125
Hsp92II CATG 2 cut(s) 138, 173
LpnPI CCDG 2 cut(s) 33, 175
Lsp1109I GCAGC 2 cut(s) 94, 131
MaeI CTAG 2 cut(s) 177, 202
MboII GAAGA 1 cut(s) 70
MluCI AATT 2 cut(s) 112, 195
MnlI CCTC 2 cut(s) 55, 141
MroXI GAANNNNTTC 2 cut(s) 29, 77
MslI CAYNNNNRTG 1 cut(s) 133
MwoI GCNNNNNNNGC 2 cut(s) 116, 125
NlaIII CATG 2 cut(s) 138, 173
PaqCI CACCTGC 1 cut(s) 170
PdmI GAANNNNTTC 2 cut(s) 29, 77
PfeI GAWTC 2 cut(s) 4, 173
PkrI GCNGC 2 cut(s) 109, 121
RseI CAYNNNNRTG 1 cut(s) 133
SatI GCNGC 2 cut(s) 108, 120
SetI ASST 4 cut(s) 124, 133, 164, 184
SfcI CTRYAG 1 cut(s) 8
SmiMI CAYNNNNRTG 1 cut(s) 133
Sse9I AATT 2 cut(s) 112, 195
SspMI CTAG 2 cut(s) 177, 202
TasI AATT 2 cut(s) 112, 195
TfiI GAWTC 2 cut(s) 4, 173
TseI GCWGC 2 cut(s) 107, 119
TspDTI ATGAA 2 cut(s) 17, 186
TspGWI ACGGA 1 cut(s) 23
XapI RAATTY 1 cut(s) 112
XbaI TCTAGA 1 cut(s) 176
XmnI GAANNNNTTC 2 cut(s) 29, 77
XspI CTAG 2 cut(s) 177, 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.