Rh3DG354500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
42896908 .. 42897647
740 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG354500.1

Sequence Viewer

Length: 315 bp
ATGATACCAGGAACAAACAAGAGAATCTTTATGAGATTATCAAATGTTTTGTTTCTTTTCACAATCGACTTTAGGATAAAACCCAAATCGGAACAGTCAACCCTAAATCATGAGTGCAAATCTCTGTTTCATTTTGTCATTCCTCCCACAACTTCATCTAAAATGTTTCTTCCTAAGTTGTGGGCTGCAAATTCGGCAGCTTTTGCACCTCCATGGCCATCAAATACATCAAAAAAAGCCTGCAAACATGAATCTAGAGCATATCAAATTCCAATTCCCCAGCCACTCATTTCAGTTGCAATAAGCAAGGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.74

Weight (kDa)

10.25

Isoelectric Point (pI)

44.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 215
AcsI RAATTY 2 cut(s) 190, 267
AjnI CCWGG 1 cut(s) 7
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
AoxI GGCC 2 cut(s) 215, 309
ApeKI GCWGC 2 cut(s) 185, 197
ApoI RAATTY 2 cut(s) 190, 267
BalI TGGCCA 1 cut(s) 217
BbvI GCAGC 2 cut(s) 172, 209
BccI CCATC 1 cut(s) 226
BciT130I CCWGG 1 cut(s) 9
BfaI CTAG 1 cut(s) 255
BisI GCNGC 2 cut(s) 186, 198
BlsI GCNGC 2 cut(s) 187, 199
Bme1390I CCNGG 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 212
BseBI CCWGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 212
BseXI GCAGC 2 cut(s) 172, 209
BseYI CCCAGC 1 cut(s) 279
BshFI GGCC 2 cut(s) 217, 311
BsnI GGCC 2 cut(s) 217, 311
Bsp19I CCATGG 1 cut(s) 212
BspANI GGCC 2 cut(s) 217, 311
BspHI TCATGA 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 212
BssT1I CCWWGG 1 cut(s) 212
Bst2UI CCWGG 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 96
BstAPI GCANNNNNTGC 1 cut(s) 203
BstC8I GCNNGC 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 174
BstDSI CCRYGG 1 cut(s) 212
BstMWI GCNNNNNNNGC 2 cut(s) 194, 203
BstNI CCWGG 1 cut(s) 9
BstSCI CCNGG 1 cut(s) 7
BstV1I GCAGC 2 cut(s) 172, 209
BsuRI GGCC 2 cut(s) 217, 311
BtgI CCRYGG 1 cut(s) 212
Cac8I GCNNGC 1 cut(s) 241
CciI TCATGA 1 cut(s) 109
CviAII CATG 3 cut(s) 110, 213, 248
CviJI RGCY 6 cut(s) 185, 200, 217, 239, 283, 311
CviKI_1 RGCY 6 cut(s) 185, 200, 217, 239, 283, 311
DdeI CTNAG 1 cut(s) 174
EaeI YGGCCR 1 cut(s) 215
Eco130I CCWWGG 1 cut(s) 212
Eco147I AGGCCT 1 cut(s) 311
EcoRII CCWGG 1 cut(s) 7
EcoT14I CCWWGG 1 cut(s) 212
ErhI CCWWGG 1 cut(s) 212
FaeI CATG 3 cut(s) 113, 216, 251
FaiI YATR 5 cut(s) 32, 111, 214, 249, 262
FalI AAGNNNNNCTT 2 cut(s) 11, 43
FatI CATG 3 cut(s) 109, 212, 247
Fnu4HI GCNGC 2 cut(s) 186, 198
Fsp4HI GCNGC 2 cut(s) 186, 198
FspBI CTAG 1 cut(s) 255
GluI GCNGC 2 cut(s) 186, 198
GsaI CCCAGC 1 cut(s) 283
HaeIII GGCC 2 cut(s) 217, 311
Hin1II CATG 3 cut(s) 113, 216, 251
HincII GTYRAC 1 cut(s) 99
HindII GTYRAC 1 cut(s) 99
HinfI GANTC 2 cut(s) 24, 251
Hpy166II GTNNAC 1 cut(s) 99
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 110, 255
Hpy8I GTNNAC 1 cut(s) 99
HpyCH4III ACNGT 1 cut(s) 96
HpyCH4V TGCA 5 cut(s) 117, 188, 206, 243, 299
HpyF10VI GCNNNNNNNGC 2 cut(s) 194, 203
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 3 cut(s) 113, 216, 251
LpnPI CCDG 3 cut(s) 21, 253, 293
Lsp1109I GCAGC 2 cut(s) 172, 209
MaeI CTAG 1 cut(s) 255
MboII GAAGA 1 cut(s) 161
MlsI TGGCCA 1 cut(s) 217
MluCI AATT 3 cut(s) 190, 267, 273
MluNI TGGCCA 1 cut(s) 217
MnlI CCTC 2 cut(s) 153, 219
Mox20I TGGCCA 1 cut(s) 217
MscI TGGCCA 1 cut(s) 217
MslI CAYNNNNRTG 1 cut(s) 211
Msp20I TGGCCA 1 cut(s) 217
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
MwoI GCNNNNNNNGC 2 cut(s) 194, 203
NcoI CCATGG 1 cut(s) 212
NlaIII CATG 3 cut(s) 113, 216, 251
PagI TCATGA 1 cut(s) 109
PceI AGGCCT 1 cut(s) 311
PfeI GAWTC 2 cut(s) 24, 251
PkrI GCNGC 2 cut(s) 187, 199
Psp6I CCWGG 1 cut(s) 7
PspFI CCCAGC 1 cut(s) 279
PspGI CCWGG 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 211
SatI GCNGC 2 cut(s) 186, 198
ScrFI CCNGG 1 cut(s) 9
SetI ASST 2 cut(s) 202, 211
SgeI CNNG 9 cut(s) 20, 21, 31, 122, 225, 252, 260, 267, 292
SmiMI CAYNNNNRTG 1 cut(s) 211
Sse9I AATT 3 cut(s) 190, 267, 273
SseBI AGGCCT 1 cut(s) 311
SspMI CTAG 1 cut(s) 255
StuI AGGCCT 1 cut(s) 311
StyD4I CCNGG 1 cut(s) 7
StyI CCWWGG 1 cut(s) 212
TaaI ACNGT 1 cut(s) 96
TaqI TCGA 1 cut(s) 66
TasI AATT 3 cut(s) 190, 267, 273
TfiI GAWTC 2 cut(s) 24, 251
TseI GCWGC 2 cut(s) 185, 197
TspDTI ATGAA 3 cut(s) 119, 144, 264
XapI RAATTY 2 cut(s) 190, 267
XbaI TCTAGA 1 cut(s) 254
XspI CTAG 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.