Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0001254

Physical Location & Seq

Genomic Coordinates Forward (+)

46991928 .. 46992331

Gene Structure 404 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ45861

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGAATACTGCCTACCAGAAAAAGTGGCCACTTTATCTTAGCACTAAAAATACTATTCTCAAGAAATATGATGGAAGGAAATTTATGAAACTCATTGGAGATCCAGATTTGAAGCCTCATCGAAATATCCCTCCCCGACGGATATTATGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005777 GO:0005886 GO:0016020 GO:0042579 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00020 ko00480 ko00720 ko01100 ko01110 ko01120 ko01130 ko01200 ko01210 ko01230 ko04146 map00020 map00480 map00720 map01100 map01110 map01120 map01130 map01200 map01210 map01230 map04146

Pfam Domains

Protein Families

Iso_dh

Protein Analysis

50

Amino Acids

6.0

Weight (kDa)

10.24

Isoelectric Point (pI)

35.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001254)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G54340 AT1G54340
fragaria_vesca	FvH4_3g13770 FvH4_3g13770 FvH4_3g13770 FvH4_3g13770 FvH4_3g13770 FvH4_3g13770 FvH4_3g13770
malus_domestica	MD05G1241100.v1.1 MD10G1219500.v1.1
prunus_persica	Prupe.4G124500_v2.0.a1 Prupe.4G124500_v2.0.a1
pyrus_communis	pycom05g21730 pycom10g18520
rosa_chinensis	RchiOBHm_Chr1g0322671 RchiOBHm_Chr1g0349881 RchiOBHm_Chr3g0487801 RchiOBHm_Chr3g0492471 RchiOBHm_Chr3g0496261 RchiOBHm_Chr3g0496271 RchiOBHm_Chr5g0022951 RchiOBHm_Chr5g0057661
rosa_laevigata	RLG00000017604 RLG00000018107 RLG00000019194 RLG00000032684
rosa_multiflora	Rmu_co8372099.1_g000001 Rmu_sc0000303.1_g000020 Rmu_sc0002263.1_g000012 Rmu_sc0002675.1_g000002 Rmu_sc0012663.1_g000003
rosa_roxburghii	Rroxscaffold_1G00056380
rosa_rugosa	Rorug05G0075800 Rorug05G0075900
rosa_samantha	Rh1BG010100 Rh1CG086100 Rh1DG139600 Rh2AG460100 Rh2BG230500 Rh2DG286700 Rh3AG284700 Rh3AG304200 Rh3AG328100 Rh3CG325200 Rh3DG354500 Rh4AG076600 Rh4CG081500 Rh5AG162200 Rh5BG161400 Rh5CG176100 Rh5CG412000 Rh5DG162800 Rh6BG196700
rosa_wichuraiana	Rw5G014600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	95
AcoI	YGGCCR	1 cut(s)	26
AcsI	RAATTY	1 cut(s)	80
AgsI	TTSAA	1 cut(s)	112
AlwI	GGATC	1 cut(s)	95
AoxI	GGCC	1 cut(s)	26
ApoI	RAATTY	1 cut(s)	80
BalI	TGGCCA	1 cut(s)	28
BccI	CCATC	1 cut(s)	65
BpuEI	CTTGAG	1 cut(s)	44
BshFI	GGCC	1 cut(s)	28
BsnI	GGCC	1 cut(s)	28
Bsp143I	GATC	1 cut(s)	100
BspANI	GGCC	1 cut(s)	28
BspPI	GGATC	1 cut(s)	95
BssMI	GATC	1 cut(s)	100
BstDEI	CTNAG	1 cut(s)	38
BstKTI	GATC	1 cut(s)	103
BstMBI	GATC	1 cut(s)	100
BstX2I	RGATCY	1 cut(s)	100
BstYI	RGATCY	1 cut(s)	100
BsuRI	GGCC	1 cut(s)	28
CviJI	RGCY	2 cut(s)	28, 115
CviKI_1	RGCY	2 cut(s)	28, 115
DdeI	CTNAG	1 cut(s)	38
DpnI	GATC	1 cut(s)	102
DpnII	GATC	1 cut(s)	100
EaeI	YGGCCR	1 cut(s)	26
FaiI	YATR	3 cut(s)	69, 86, 148
HaeIII	GGCC	1 cut(s)	28
Hpy188III	TCNNGA	2 cut(s)	61, 104
Hpy99I	CGWCG	1 cut(s)	141
HpyAV	CCTTC	1 cut(s)	69
HpyF3I	CTNAG	1 cut(s)	38
Kzo9I	GATC	1 cut(s)	100
LpnPI	CCDG	2 cut(s)	29, 117
MalI	GATC	1 cut(s)	102
MboI	GATC	1 cut(s)	100
MflI	RGATCY	1 cut(s)	100
MlsI	TGGCCA	1 cut(s)	28
MluCI	AATT	1 cut(s)	80
MluNI	TGGCCA	1 cut(s)	28
MnlI	CCTC	2 cut(s)	126, 141
Mox20I	TGGCCA	1 cut(s)	28
MscI	TGGCCA	1 cut(s)	28
Msp20I	TGGCCA	1 cut(s)	28
NdeII	GATC	1 cut(s)	100
PsuI	RGATCY	1 cut(s)	100
Sau3AI	GATC	1 cut(s)	100
SgeI	CNNG	4 cut(s)	28, 73, 116, 147
SmlI	CTYRAG	1 cut(s)	59
SmoI	CTYRAG	1 cut(s)	59
Sse9I	AATT	1 cut(s)	80
TaqI	TCGA	1 cut(s)	121
TasI	AATT	1 cut(s)	80
TspDTI	ATGAA	2 cut(s)	17, 101
XapI	RAATTY	1 cut(s)	80

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.