Rh4CG081500

Catalyzes the rate-limiting step of the oxidative pentose-phosphate pathway, which represents a route for the dissimilation of carbohydrates besides glycolysis

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
14509325 .. 14510196
872 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG081500.1

Sequence Viewer

Length: 372 bp
ATGATGTTGAAACTTACTCTTTTTTTTTTCCCTCCAATGTCTATTACAGGCATAAATGAGTTGCAAGAAGGTTTTGTTGAAGCGAAAATGGCACTAACCAGTTGCAAAAATGGCACTAACCAGTTCCACCTTTTTAAGCAGGGGTTTCTGAATCCAAATGAAGTTCACATTTTCGGCTATGCAAGGACTAAGATTTCTTATGATGAGCTAAGAAGCCGCATACGTGGATATCTCAACCAAGGAGCTTCGTCCAAGGACTTGGATGATGTAACCAAATTTTTGCAACTGGTTAGTGCCATAAAATGGCACAAGAAGGTTTTGTTGAAGCGAAAAGATATTATATCAGCTTTTGATTCATGTGTAGCTAGCTAG

Protein Analysis

123

Amino Acids

14.04

Weight (kDa)

9.48

Isoelectric Point (pI)

42.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 303
AciI CCGC 1 cut(s) 217
AcsI RAATTY 1 cut(s) 275
AfiI CCNNNNNNNGG 1 cut(s) 303
AgsI TTSAA 3 cut(s) 10, 80, 325
AluBI AGCT 5 cut(s) 208, 245, 347, 365, 369
AluI AGCT 5 cut(s) 208, 245, 347, 365, 369
ApoI RAATTY 1 cut(s) 275
AsuNHI GCTAGC 1 cut(s) 365
BfaI CTAG 2 cut(s) 366, 370
BisI GCNGC 1 cut(s) 217
BlsI GCNGC 1 cut(s) 218
BmtI GCTAGC 1 cut(s) 369
BsaAI YACGTR 1 cut(s) 224
BsaJI CCNNGG 2 cut(s) 238, 252
Bsc4I CCNNNNNNNGG 1 cut(s) 303
Bse1I ACTGG 3 cut(s) 99, 121, 291
BseDI CCNNGG 2 cut(s) 238, 252
BseGI GGATG 1 cut(s) 268
BseLI CCNNNNNNNGG 1 cut(s) 303
BseNI ACTGG 3 cut(s) 99, 121, 291
BslI CCNNNNNNNGG 1 cut(s) 303
BspACI CCGC 1 cut(s) 217
BspOI GCTAGC 1 cut(s) 369
BsrI ACTGG 3 cut(s) 99, 121, 291
BssECI CCNNGG 2 cut(s) 238, 252
BssT1I CCWWGG 2 cut(s) 238, 252
BstBAI YACGTR 1 cut(s) 224
BstC8I GCNNGC 1 cut(s) 367
BstDEI CTNAG 2 cut(s) 189, 209
BstF5I GGATG 1 cut(s) 268
BstMWI GCNNNNNNNGC 2 cut(s) 89, 111
BstXI CCANNNNNNTGG 1 cut(s) 259
BtsCI GGATG 1 cut(s) 268
Cac8I GCNNGC 1 cut(s) 367
CviAII CATG 1 cut(s) 357
CviJI RGCY 7 cut(s) 177, 208, 216, 245, 347, 365, 369
CviKI_1 RGCY 7 cut(s) 177, 208, 216, 245, 347, 365, 369
DdeI CTNAG 2 cut(s) 189, 209
Eco130I CCWWGG 2 cut(s) 238, 252
Eco32I GATATC 1 cut(s) 230
EcoRV GATATC 1 cut(s) 230
EcoT14I CCWWGG 2 cut(s) 238, 252
ErhI CCWWGG 2 cut(s) 238, 252
FaeI CATG 1 cut(s) 360
FaiI YATR 7 cut(s) 53, 180, 201, 221, 299, 341, 358
FatI CATG 1 cut(s) 356
Fnu4HI GCNGC 1 cut(s) 217
FokI GGATG 1 cut(s) 275
Fsp4HI GCNGC 1 cut(s) 217
FspBI CTAG 2 cut(s) 366, 370
GluI GCNGC 1 cut(s) 217
Hin1II CATG 1 cut(s) 360
HinfI GANTC 2 cut(s) 151, 353
Hpy166II GTNNAC 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 150
Hpy8I GTNNAC 1 cut(s) 166
HpyAV CCTTC 2 cut(s) 62, 307
HpyCH4IV ACGT 1 cut(s) 223
HpyCH4V TGCA 4 cut(s) 64, 105, 182, 283
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 111
HpyF3I CTNAG 2 cut(s) 189, 209
HpySE526I ACGT 1 cut(s) 223
Hsp92II CATG 1 cut(s) 360
LmnI GCTCC 1 cut(s) 242
LpnPI CCDG 5 cut(s) 33, 112, 125, 134, 272
MaeI CTAG 2 cut(s) 366, 370
MaeII ACGT 1 cut(s) 223
MaeIII GTNAC 1 cut(s) 268
MluCI AATT 1 cut(s) 275
MnlI CCTC 1 cut(s) 42
MseI TTAA 1 cut(s) 135
MwoI GCNNNNNNNGC 2 cut(s) 89, 111
NheI GCTAGC 1 cut(s) 365
NlaIII CATG 1 cut(s) 360
PfeI GAWTC 2 cut(s) 151, 353
PflMI CCANNNNNTGG 1 cut(s) 303
PkrI GCNGC 1 cut(s) 218
Ppu21I YACGTR 1 cut(s) 224
SaqAI TTAA 1 cut(s) 135
SatI GCNGC 1 cut(s) 217
SetI ASST 9 cut(s) 73, 132, 210, 226, 247, 318, 349, 367, 371
Sse9I AATT 1 cut(s) 275
SsiI CCGC 1 cut(s) 217
SspMI CTAG 2 cut(s) 366, 370
StyI CCWWGG 2 cut(s) 238, 252
TaiI ACGT 1 cut(s) 226
TasI AATT 1 cut(s) 275
TauI GCSGC 1 cut(s) 219
TfiI GAWTC 2 cut(s) 151, 353
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TspDTI ATGAA 2 cut(s) 174, 345
Van91I CCANNNNNTGG 1 cut(s) 303
XapI RAATTY 1 cut(s) 275
XspI CTAG 2 cut(s) 366, 370
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.