RchiOBHm_Chr2g0170281

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
84243462 .. 84248473
5012 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGCTTATACTCTTGAAACTGCTGTTTTATTCAGTATGCTCGAAACTACAGGATCTGAGATATGGTGACATCTTTGTAACGGCAATTGGTAGCGGAGGCACCATCTCTGGGGTTGGACAGTATCTCAAATCTCAAAACCCTGATTGTAAGATATACGGAGTGGAGCCTGCTGAAAGTAATAATATACTAAATGGCGGTAAACCAGGTCTTCATTCGATTACTAGCAATGGGGTTGGATTCAAACCCAATATATTGGGCATGTTGAGGTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.5

Weight (kDa)

9.03

Isoelectric Point (pI)

30.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 23 - 66 2.4e-10 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 98
AciI CCGC 2 cut(s) 93, 195
AclWI GGATC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 2 cut(s) 16, 241
AjnI CCWGG 1 cut(s) 202
AlwI GGATC 1 cut(s) 60
AlwNI CAGNNNCTG 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 77
BanI GGYRCC 1 cut(s) 98
BbsI GAAGAC 1 cut(s) 200
BccI CCATC 1 cut(s) 110
BceAI ACGGC 1 cut(s) 96
BciT130I CCWGG 1 cut(s) 204
BfaI CTAG 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 204
BmiI GGNNCC 2 cut(s) 100, 165
BmrFI CCNGG 1 cut(s) 204
BpiI GAAGAC 1 cut(s) 200
Bsc4I CCNNNNNNNGG 1 cut(s) 108
Bse3DI GCAATG 1 cut(s) 232
BseBI CCWGG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 232
BseMII CTCAG 1 cut(s) 47
BshNI GGYRCC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 108
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 2 cut(s) 93, 195
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 2 cut(s) 100, 165
BspPI GGATC 1 cut(s) 60
BspT107I GGYRCC 1 cut(s) 98
BsrDI GCAATG 1 cut(s) 232
BssMI GATC 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 204
Bst4CI ACNGT 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstNI CCWGG 1 cut(s) 204
BstNSI RCATGY 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 202
BstSFI CTRYAG 1 cut(s) 47
BstV2I GAAGAC 1 cut(s) 200
BstX2I RGATCY 1 cut(s) 52
BstXI CCANNNNNNTGG 1 cut(s) 253
BstYI RGATCY 1 cut(s) 52
Cac8I GCNNGC 1 cut(s) 168
CaiI CAGNNNCTG 1 cut(s) 55
CsiI ACCWGGT 1 cut(s) 202
CviAII CATG 1 cut(s) 259
CviJI RGCY 1 cut(s) 166
CviKI_1 RGCY 1 cut(s) 166
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
EcoRII CCWGG 1 cut(s) 202
FaeI CATG 1 cut(s) 262
FaiI YATR 7 cut(s) 8, 37, 63, 154, 185, 251, 260
FatI CATG 1 cut(s) 258
FspBI CTAG 1 cut(s) 222
Hin1II CATG 1 cut(s) 262
HinfI GANTC 1 cut(s) 237
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 200
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 200
HpyCH4III ACNGT 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 1 cut(s) 262
Kzo9I GATC 1 cut(s) 52
LmnI GCTCC 1 cut(s) 163
LpnPI CCDG 6 cut(s) 35, 93, 153, 180, 189, 216
MabI ACCWGGT 1 cut(s) 202
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 2 cut(s) 65, 76
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 1 cut(s) 200
MfeI CAATTG 1 cut(s) 84
MflI RGATCY 1 cut(s) 52
MluCI AATT 1 cut(s) 84
MmeI TCCRAC 2 cut(s) 94, 214
MnlI CCTC 2 cut(s) 89, 258
MspR9I CCNGG 1 cut(s) 204
MunI CAATTG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 204
NdeII GATC 1 cut(s) 52
NlaIII CATG 1 cut(s) 262
NlaIV GGNNCC 2 cut(s) 100, 165
NmuCI GTSAC 1 cut(s) 65
NspI RCATGY 1 cut(s) 262
PfeI GAWTC 1 cut(s) 237
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
PspN4I GGNNCC 2 cut(s) 100, 165
PstNI CAGNNNCTG 1 cut(s) 55
PsuI RGATCY 1 cut(s) 52
Sau3AI GATC 1 cut(s) 52
ScrFI CCNGG 1 cut(s) 204
SetI ASST 2 cut(s) 208, 269
SexAI ACCWGGT 1 cut(s) 202
SfcI CTRYAG 1 cut(s) 47
SgeI CNNG 9 cut(s) 25, 52, 62, 120, 152, 179, 215, 216, 234
Sse9I AATT 1 cut(s) 84
SsiI CCGC 2 cut(s) 93, 195
SspMI CTAG 1 cut(s) 222
StyD4I CCNGG 1 cut(s) 202
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 2 cut(s) 41, 215
TasI AATT 1 cut(s) 84
TfiI GAWTC 1 cut(s) 237
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 1 cut(s) 200
TspGWI ACGGA 1 cut(s) 171
XceI RCATGY 1 cut(s) 262
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.