Rroxscaffold_1G00025850

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
32461123 .. 32464841
3719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00025850.1

Sequence Viewer

Length: 303 bp
ATGGGAGGAACTGTCAAGAAGGCTTATGACCTTTTGGAATCCACTCCAAATGCCCTTACACTCCAACAATTCTCAAACCCCGCCAATACTCAGGACCTGAGATATGGTGACACCTTTGTAATGGGAATTGGTAGCGGAGGCACCATCTCTGGGGTTGGACAGTATCTCAAATCTCAATACCCTGATTGTAAGATATATGGAGTGGAGCCTGCTGAAAGTAATAATATACTAAATGGTGGTAAACCAGGTAGAAACCCTAAAGTACTGCTAGAGAATCGATCAGACACCTATTTCTCTGAGTAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

10.8

Weight (kDa)

5.34

Isoelectric Point (pI)

32.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 10 - 84 7e-11 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 140
AciI CCGC 2 cut(s) 81, 135
AfaI GTAC 1 cut(s) 264
AfiI CCNNNNNNNGG 1 cut(s) 150
AjnI CCWGG 1 cut(s) 244
AlwNI CAGNNNCTG 1 cut(s) 97
AspS9I GGNCC 1 cut(s) 94
AsuHPI GGTGA 1 cut(s) 119
AvaII GGWCC 1 cut(s) 94
BanI GGYRCC 1 cut(s) 140
BccI CCATC 1 cut(s) 152
BciT130I CCWGG 1 cut(s) 246
BfaI CTAG 1 cut(s) 269
BmcAI AGTACT 1 cut(s) 264
Bme1390I CCNGG 1 cut(s) 246
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 2 cut(s) 142, 207
BmrFI CCNGG 1 cut(s) 246
Bsa29I ATCGAT 1 cut(s) 277
BsaXI ACNNNNNCTCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 246
BseCI ATCGAT 1 cut(s) 277
BseLI CCNNNNNNNGG 1 cut(s) 150
BseMII CTCAG 3 cut(s) 89, 104, 288
BshNI GGYRCC 1 cut(s) 140
BshVI ATCGAT 1 cut(s) 277
BslI CCNNNNNNNGG 1 cut(s) 150
Bsp143I GATC 1 cut(s) 278
BspACI CCGC 2 cut(s) 81, 135
BspCNI CTCAG 3 cut(s) 90, 103, 289
BspDI ATCGAT 1 cut(s) 277
BspLI GGNNCC 2 cut(s) 142, 207
BspT107I GGYRCC 1 cut(s) 140
BssMI GATC 1 cut(s) 278
Bst2UI CCWGG 1 cut(s) 246
Bst4CI ACNGT 2 cut(s) 13, 162
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 3 cut(s) 90, 98, 297
BstKTI GATC 1 cut(s) 281
BstMBI GATC 1 cut(s) 278
BstNI CCWGG 1 cut(s) 246
BstSCI CCNGG 1 cut(s) 244
Bsu15I ATCGAT 1 cut(s) 277
BsuTUI ATCGAT 1 cut(s) 277
Cac8I GCNNGC 1 cut(s) 210
CaiI CAGNNNCTG 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 94
ClaI ATCGAT 1 cut(s) 277
CsiI ACCWGGT 1 cut(s) 244
Csp6I GTAC 1 cut(s) 263
CviJI RGCY 2 cut(s) 23, 208
CviKI_1 RGCY 2 cut(s) 23, 208
CviQI GTAC 1 cut(s) 263
DdeI CTNAG 3 cut(s) 90, 98, 297
DpnI GATC 1 cut(s) 280
DpnII GATC 1 cut(s) 278
Eco47I GGWCC 1 cut(s) 94
EcoO109I RGGNCCY 1 cut(s) 94
EcoRII CCWGG 1 cut(s) 244
FaiI YATR 5 cut(s) 27, 105, 196, 198, 227
FauI CCCGC 1 cut(s) 88
FspBI CTAG 1 cut(s) 269
HinfI GANTC 2 cut(s) 38, 274
HphI GGTGA 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 242
Hpy188I TCNGA 2 cut(s) 283, 298
Hpy188III TCNNGA 2 cut(s) 16, 92
Hpy8I GTNNAC 1 cut(s) 242
HpyAV CCTTC 1 cut(s) 13
HpyCH4III ACNGT 2 cut(s) 13, 162
HpyF3I CTNAG 3 cut(s) 90, 98, 297
Kzo9I GATC 1 cut(s) 278
LmnI GCTCC 1 cut(s) 205
LpnPI CCDG 7 cut(s) 77, 110, 135, 195, 222, 231, 258
MabI ACCWGGT 1 cut(s) 244
MaeI CTAG 1 cut(s) 269
MaeIII GTNAC 1 cut(s) 107
MalI GATC 1 cut(s) 280
MboI GATC 1 cut(s) 278
MluCI AATT 2 cut(s) 68, 126
MmeI TCCRAC 2 cut(s) 88, 136
MnlI CCTC 1 cut(s) 131
MspR9I CCNGG 1 cut(s) 246
MvaI CCWGG 1 cut(s) 246
NdeII GATC 1 cut(s) 278
NlaIV GGNNCC 2 cut(s) 142, 207
NmuCI GTSAC 1 cut(s) 107
PfeI GAWTC 2 cut(s) 38, 274
PpuMI RGGWCCY 1 cut(s) 94
Psp5II RGGWCCY 1 cut(s) 94
Psp6I CCWGG 1 cut(s) 244
PspGI CCWGG 1 cut(s) 244
PspN4I GGNNCC 2 cut(s) 142, 207
PspPI GGNCC 1 cut(s) 94
PspPPI RGGWCCY 1 cut(s) 94
PstNI CAGNNNCTG 1 cut(s) 97
RsaI GTAC 1 cut(s) 264
RsaNI GTAC 1 cut(s) 263
Sau3AI GATC 1 cut(s) 278
Sau96I GGNCC 1 cut(s) 94
ScaI AGTACT 1 cut(s) 264
ScrFI CCNGG 1 cut(s) 246
SetI ASST 5 cut(s) 33, 99, 116, 250, 290
SexAI ACCWGGT 1 cut(s) 244
SinI GGWCC 1 cut(s) 94
Sse9I AATT 2 cut(s) 68, 126
SsiI CCGC 2 cut(s) 81, 135
SspMI CTAG 1 cut(s) 269
StyD4I CCNGG 1 cut(s) 244
TaaI ACNGT 2 cut(s) 13, 162
TaqI TCGA 1 cut(s) 277
TasI AATT 2 cut(s) 68, 126
TatI WGTACW 1 cut(s) 262
TfiI GAWTC 2 cut(s) 38, 274
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 94
XspI CTAG 1 cut(s) 269
ZrmI AGTACT 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.