Rroxscaffold_3G00237260

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
24868312 .. 24875428
7117 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00237260.1

Sequence Viewer

Length: 285 bp
ATGACCTTTTGGAATCCACTCCAAATGCCTTTATGCTCAAACCCTGCCAAGACTCAGGTACATTCTGAAACTGCAGGACCTGAGATATGGGAGGATACTAATGGAAAAGTTGACATCTTTGTAATAGGAATTGGTAGCGGAGGCACCATCTCTGGGGTTGGACAGTATCTCAAATCTCAAAACCCTGATTGTAATCTACTTTGTGTATGTGATTTCACTGACAGTCTTCATCACCAGTGTGCTTCCATTGAATCAAGGAGAGAATGGAGTCAAAATGGACGTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.35

Weight (kDa)

5.1

Isoelectric Point (pI)

33.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 11 - 70 4.4e-14 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 143
AciI CCGC 1 cut(s) 138
AfaI GTAC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 153
AgsI TTSAA 1 cut(s) 251
AleI CACNNNNGTG 1 cut(s) 237
AlwNI CAGNNNCTG 1 cut(s) 80
AspS9I GGNCC 1 cut(s) 77
AsuHPI GGTGA 1 cut(s) 224
AvaII GGWCC 1 cut(s) 77
BanI GGYRCC 1 cut(s) 143
BbsI GAAGAC 1 cut(s) 218
BccI CCATC 1 cut(s) 155
BciVI GTATCC 1 cut(s) 88
BfmI CTRYAG 1 cut(s) 72
BfuI GTATCC 1 cut(s) 88
Bme18I GGWCC 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 77
BmiI GGNNCC 1 cut(s) 145
BpiI GAAGAC 1 cut(s) 218
BsaBI GATNNNNATC 1 cut(s) 192
Bsc4I CCNNNNNNNGG 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 235
Bse8I GATNNNNATC 1 cut(s) 192
BseJI GATNNNNATC 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 153
BseMII CTCAG 2 cut(s) 68, 72
BseNI ACTGG 1 cut(s) 235
BshNI GGYRCC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 153
BspACI CCGC 1 cut(s) 138
BspCNI CTCAG 2 cut(s) 67, 73
BspLI GGNNCC 1 cut(s) 145
BspMAI CTGCAG 1 cut(s) 76
BspT107I GGYRCC 1 cut(s) 143
BsrI ACTGG 1 cut(s) 235
Bst4CI ACNGT 2 cut(s) 165, 224
BstDEI CTNAG 2 cut(s) 54, 81
BstSFI CTRYAG 1 cut(s) 72
BstV2I GAAGAC 1 cut(s) 218
BsuI GTATCC 1 cut(s) 88
BtsIMutI CAGTG 2 cut(s) 216, 242
CaiI CAGNNNCTG 1 cut(s) 80
Cfr13I GGNCC 1 cut(s) 77
Csp6I GTAC 1 cut(s) 59
CviQI GTAC 1 cut(s) 59
DdeI CTNAG 2 cut(s) 54, 81
Eco47I GGWCC 1 cut(s) 77
EcoO109I RGGNCCY 1 cut(s) 77
FaiI YATR 3 cut(s) 34, 88, 208
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HinfI GANTC 4 cut(s) 13, 52, 251, 268
HphI GGTGA 1 cut(s) 224
Hpy166II GTNNAC 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 112
HpyCH4III ACNGT 2 cut(s) 165, 224
HpyCH4IV ACGT 1 cut(s) 280
HpyCH4V TGCA 1 cut(s) 74
HpyF3I CTNAG 2 cut(s) 54, 81
HpySE526I ACGT 1 cut(s) 280
LpnPI CCDG 7 cut(s) 41, 57, 60, 93, 138, 198, 248
MaeII ACGT 1 cut(s) 280
MboII GAAGA 1 cut(s) 218
MluCI AATT 1 cut(s) 129
MlyI GAGTC 2 cut(s) 46, 277
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 2 cut(s) 85, 134
MslI CAYNNNNRTG 1 cut(s) 237
NlaIV GGNNCC 1 cut(s) 145
OliI CACNNNNGTG 1 cut(s) 237
PfeI GAWTC 2 cut(s) 13, 251
PleI GAGTC 2 cut(s) 46, 276
PpsI GAGTC 2 cut(s) 46, 276
PpuMI RGGWCCY 1 cut(s) 77
Psp5II RGGWCCY 1 cut(s) 77
PspN4I GGNNCC 1 cut(s) 145
PspPI GGNCC 1 cut(s) 77
PspPPI RGGWCCY 1 cut(s) 77
PstI CTGCAG 1 cut(s) 76
PstNI CAGNNNCTG 1 cut(s) 80
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
RseI CAYNNNNRTG 1 cut(s) 237
Sau96I GGNCC 1 cut(s) 77
SchI GAGTC 2 cut(s) 46, 277
SetI ASST 4 cut(s) 8, 60, 82, 283
SfcI CTRYAG 1 cut(s) 72
SgeI CNNG 9 cut(s) 56, 61, 68, 87, 92, 165, 197, 247, 267
SinI GGWCC 1 cut(s) 77
SmiMI CAYNNNNRTG 1 cut(s) 237
Sse9I AATT 1 cut(s) 129
SsiI CCGC 1 cut(s) 138
TaaI ACNGT 2 cut(s) 165, 224
TaiI ACGT 1 cut(s) 283
TasI AATT 1 cut(s) 129
TfiI GAWTC 2 cut(s) 13, 251
TscAI CASTG 2 cut(s) 223, 242
TspDTI ATGAA 1 cut(s) 218
TspRI CASTG 2 cut(s) 223, 242
VpaK11BI GGWCC 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.