Rmu_sc0009428.1_g000004

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009428.1
Physical Location & Seq
Reverse (-)
29057 .. 30927
1871 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009428.1_g000004.1.cds

Sequence Viewer

Length: 294 bp
atgcttatactcttgaaactgctgttttattcagtatgctcgaaactacaggatctgagatatgttgacatctttgtaacgggaattggtagcggaggcaccatctctggggttgaacagtatctcaaatctcaataccctgattgtaagatatatggagtggagcctgctgaaagtaataatatactaaatggtggtaaaccaggtcctcattcgattactagcaatggggttggattcaaacccaatatattgggcatggacataatgaaagagttcttgagtgcttattga
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.57

Weight (kDa)

6.53

Isoelectric Point (pI)

27.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 98
AciI CCGC 1 cut(s) 93
AclWI GGATC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 3 cut(s) 16, 116, 241
AjnI CCWGG 1 cut(s) 202
AlwI GGATC 1 cut(s) 60
AlwNI CAGNNNCTG 1 cut(s) 55
Asp700I GAANNNNTTC 1 cut(s) 275
AspS9I GGNCC 1 cut(s) 206
AvaII GGWCC 1 cut(s) 206
BanI GGYRCC 1 cut(s) 98
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 204
BfaI CTAG 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 204
Bme18I GGWCC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 206
BmiI GGNNCC 2 cut(s) 100, 165
BmrFI CCNGG 1 cut(s) 204
Bsc4I CCNNNNNNNGG 1 cut(s) 108
Bse3DI GCAATG 1 cut(s) 232
BseBI CCWGG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 232
BseMII CTCAG 1 cut(s) 47
BshNI GGYRCC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 108
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 1 cut(s) 93
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 2 cut(s) 100, 165
BspPI GGATC 1 cut(s) 60
BspT107I GGYRCC 1 cut(s) 98
BsrDI GCAATG 1 cut(s) 232
BssMI GATC 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 204
Bst4CI ACNGT 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstNI CCWGG 1 cut(s) 204
BstSCI CCNGG 1 cut(s) 202
BstSFI CTRYAG 1 cut(s) 47
BstX2I RGATCY 1 cut(s) 52
BstXI CCANNNNNNTGG 1 cut(s) 253
BstYI RGATCY 1 cut(s) 52
Cac8I GCNNGC 1 cut(s) 168
CaiI CAGNNNCTG 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 206
CsiI ACCWGGT 1 cut(s) 202
CviAII CATG 1 cut(s) 259
CviJI RGCY 1 cut(s) 166
CviKI_1 RGCY 1 cut(s) 166
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 206
EcoO109I RGGNCCY 1 cut(s) 206
EcoRII CCWGG 1 cut(s) 202
FaeI CATG 1 cut(s) 262
FaiI YATR 9 cut(s) 8, 37, 63, 154, 156, 185, 251, 260, 266
FatI CATG 1 cut(s) 258
FspBI CTAG 1 cut(s) 222
Hin1II CATG 1 cut(s) 262
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HinfI GANTC 1 cut(s) 237
Hpy166II GTNNAC 2 cut(s) 67, 200
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 2 cut(s) 13, 280
Hpy8I GTNNAC 2 cut(s) 67, 200
HpyCH4III ACNGT 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 1 cut(s) 262
Kzo9I GATC 1 cut(s) 52
LmnI GCTCC 1 cut(s) 163
LpnPI CCDG 6 cut(s) 35, 93, 153, 180, 189, 216
MabI ACCWGGT 1 cut(s) 202
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MflI RGATCY 1 cut(s) 52
MluCI AATT 1 cut(s) 84
MmeI TCCRAC 1 cut(s) 214
MnlI CCTC 2 cut(s) 89, 219
MroXI GAANNNNTTC 1 cut(s) 275
MspR9I CCNGG 1 cut(s) 204
MvaI CCWGG 1 cut(s) 204
NdeII GATC 1 cut(s) 52
NlaIII CATG 1 cut(s) 262
NlaIV GGNNCC 2 cut(s) 100, 165
PdmI GAANNNNTTC 1 cut(s) 275
PfeI GAWTC 1 cut(s) 237
PpuMI RGGWCCY 1 cut(s) 206
Psp5II RGGWCCY 1 cut(s) 206
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
PspN4I GGNNCC 2 cut(s) 100, 165
PspPI GGNCC 1 cut(s) 206
PspPPI RGGWCCY 1 cut(s) 206
PstNI CAGNNNCTG 1 cut(s) 55
PsuI RGATCY 1 cut(s) 52
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 206
ScrFI CCNGG 1 cut(s) 204
SetI ASST 1 cut(s) 208
SexAI ACCWGGT 1 cut(s) 202
SfcI CTRYAG 1 cut(s) 47
SinI GGWCC 1 cut(s) 206
SmlI CTYRAG 1 cut(s) 280
SmoI CTYRAG 1 cut(s) 280
Sse9I AATT 1 cut(s) 84
SsiI CCGC 1 cut(s) 93
SspMI CTAG 1 cut(s) 222
StyD4I CCNGG 1 cut(s) 202
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 2 cut(s) 41, 215
TasI AATT 1 cut(s) 84
TfiI GAWTC 1 cut(s) 237
TspDTI ATGAA 1 cut(s) 284
VpaK11BI GGWCC 1 cut(s) 206
XmnI GAANNNNTTC 1 cut(s) 275
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.