Rmu_sc0001644.1_g000033

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001644.1
Physical Location & Seq
Forward (+)
157256 .. 158900
1645 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001644.1_g000033.1.cds

Sequence Viewer

Length: 222 bp
atgtccagactccagaatgagtcggttagactcctgactttgattatgtatctcaaatctcaataccctgattgtaagatatatggagtggagcctgctgaaagtaataatatactaaatggtggtaaaccaggtcctcattcgattactagcaatggggttggattcaaacccaatatattgggcatggacataatgaaagagttcttgagtgcttattga
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.09

Weight (kDa)

7.87

Isoelectric Point (pI)

43.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 169
AjnI CCWGG 1 cut(s) 130
Asp700I GAANNNNTTC 1 cut(s) 203
AspS9I GGNCC 1 cut(s) 134
AvaII GGWCC 1 cut(s) 134
BciT130I CCWGG 1 cut(s) 132
BfaI CTAG 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 132
Bme18I GGWCC 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 132
Bse3DI GCAATG 1 cut(s) 160
BseBI CCWGG 1 cut(s) 132
BseMI GCAATG 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 96
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BstXI CCANNNNNNTGG 1 cut(s) 181
Cac8I GCNNGC 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 134
CsiI ACCWGGT 1 cut(s) 130
CviAII CATG 1 cut(s) 187
CviJI RGCY 1 cut(s) 94
CviKI_1 RGCY 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 134
EcoO109I RGGNCCY 1 cut(s) 134
EcoRII CCWGG 1 cut(s) 130
FaeI CATG 1 cut(s) 190
FaiI YATR 7 cut(s) 47, 82, 84, 113, 179, 188, 194
FatI CATG 1 cut(s) 186
FspBI CTAG 1 cut(s) 150
Hin1II CATG 1 cut(s) 190
HinfI GANTC 4 cut(s) 9, 20, 30, 165
Hpy166II GTNNAC 1 cut(s) 128
Hpy188III TCNNGA 4 cut(s) 6, 13, 34, 208
Hpy8I GTNNAC 1 cut(s) 128
Hsp92II CATG 1 cut(s) 190
LmnI GCTCC 1 cut(s) 91
LpnPI CCDG 7 cut(s) 19, 26, 47, 81, 108, 117, 144
MabI ACCWGGT 1 cut(s) 130
MaeI CTAG 1 cut(s) 150
MlyI GAGTC 3 cut(s) 3, 24, 29
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 1 cut(s) 147
MroXI GAANNNNTTC 1 cut(s) 203
MspR9I CCNGG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 132
NlaIII CATG 1 cut(s) 190
NlaIV GGNNCC 1 cut(s) 93
PdmI GAANNNNTTC 1 cut(s) 203
PfeI GAWTC 1 cut(s) 165
PleI GAGTC 3 cut(s) 3, 24, 28
PpsI GAGTC 3 cut(s) 3, 24, 28
PpuMI RGGWCCY 1 cut(s) 134
Psp5II RGGWCCY 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 130
PspGI CCWGG 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 134
PspPPI RGGWCCY 1 cut(s) 134
Sau96I GGNCC 1 cut(s) 134
SchI GAGTC 3 cut(s) 3, 24, 29
ScrFI CCNGG 1 cut(s) 132
SetI ASST 1 cut(s) 136
SexAI ACCWGGT 1 cut(s) 130
SgeI CNNG 9 cut(s) 18, 25, 46, 80, 107, 143, 144, 162, 199
SinI GGWCC 1 cut(s) 134
SmlI CTYRAG 1 cut(s) 208
SmoI CTYRAG 1 cut(s) 208
SspMI CTAG 1 cut(s) 150
StyD4I CCNGG 1 cut(s) 130
TaqI TCGA 1 cut(s) 143
TfiI GAWTC 1 cut(s) 165
TspDTI ATGAA 1 cut(s) 212
VpaK11BI GGWCC 1 cut(s) 134
XmnI GAANNNNTTC 1 cut(s) 203
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.