RchiOBHm_Chr7g0222251

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
43561497 .. 43562816
1320 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19890

Sequence Viewer

Length: 150 bp
ATGTTCAATGATGCTGAAAAGAAAGGCTTATTAACTCCTGGAGTGAAAACTCTGATAGAGCCAACATCAGGAAACATGGGAATCAGCATGGCTTTTATGGCCGCAGTGAAAGGGTACAAGATGGTTTTGACCATGCCGTCACGAGCTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.24

Weight (kDa)

9.7

Isoelectric Point (pI)

41.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 8 - 48 7.9e-09 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 136
AciI CCGC 1 cut(s) 102
AcoI YGGCCR 1 cut(s) 99
AfaI GTAC 1 cut(s) 116
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 1 cut(s) 7
AjnI CCWGG 1 cut(s) 37
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
AoxI GGCC 1 cut(s) 99
BauI CACGAG 1 cut(s) 141
BccI CCATC 1 cut(s) 115
BceAI ACGGC 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 39
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 39
BpmI CTGGAG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 68
BseBI CCWGG 1 cut(s) 39
BseLI CCNNNNNNNGG 1 cut(s) 68
BshFI GGCC 1 cut(s) 101
BslI CCNNNNNNNGG 1 cut(s) 68
BsnI GGCC 1 cut(s) 101
BspACI CCGC 1 cut(s) 102
BspANI GGCC 1 cut(s) 101
BssSI CACGAG 1 cut(s) 141
Bst2BI CACGAG 1 cut(s) 141
Bst2UI CCWGG 1 cut(s) 39
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNI CCWGG 1 cut(s) 39
BstSCI CCNGG 1 cut(s) 37
BsuRI GGCC 1 cut(s) 101
BtsI GCAGTG 1 cut(s) 111
BtsIMutI CAGTG 1 cut(s) 111
Csp6I GTAC 1 cut(s) 115
CviAII CATG 3 cut(s) 76, 88, 133
CviJI RGCY 5 cut(s) 27, 61, 92, 101, 146
CviKI_1 RGCY 5 cut(s) 27, 61, 92, 101, 146
CviQI GTAC 1 cut(s) 115
DrdI GACNNNNNNGTC 1 cut(s) 136
DseDI GACNNNNNNGTC 1 cut(s) 136
EaeI YGGCCR 1 cut(s) 99
EcoRII CCWGG 1 cut(s) 37
FaeI CATG 3 cut(s) 79, 91, 136
FaiI YATR 4 cut(s) 77, 89, 98, 134
FalI AAGNNNNNCTT 2 cut(s) 11, 43
FatI CATG 3 cut(s) 75, 87, 132
Fnu4HI GCNGC 1 cut(s) 102
Fsp4HI GCNGC 1 cut(s) 102
GluI GCNGC 1 cut(s) 102
GsuI CTGGAG 1 cut(s) 60
HaeIII GGCC 1 cut(s) 101
Hin1II CATG 3 cut(s) 79, 91, 136
HinfI GANTC 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 2 cut(s) 69, 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
Hsp92II CATG 3 cut(s) 79, 91, 136
LpnPI CCDG 3 cut(s) 24, 51, 54
MaeIII GTNAC 1 cut(s) 138
MseI TTAA 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 39
MvaI CCWGG 1 cut(s) 39
MwoI GCNNNNNNNGC 1 cut(s) 98
NlaIII CATG 3 cut(s) 79, 91, 136
NmuCI GTSAC 1 cut(s) 138
PfeI GAWTC 1 cut(s) 81
PfoI TCCNGGA 1 cut(s) 37
PkrI GCNGC 1 cut(s) 103
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
SaqAI TTAA 1 cut(s) 32
SatI GCNGC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 39
SetI ASST 1 cut(s) 148
SgeI CNNG 7 cut(s) 50, 51, 81, 88, 100, 130, 145
SsiI CCGC 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 37
TauI GCSGC 1 cut(s) 104
TfiI GAWTC 1 cut(s) 81
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TscAI CASTG 1 cut(s) 111
TseFI GTSAC 1 cut(s) 138
Tsp45I GTSAC 1 cut(s) 138
TspRI CASTG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.