RchiOBHm_Chr5g0054831

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
57533604 .. 57534409
806 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33190

Sequence Viewer

Length: 354 bp
ATGGGAGGAACTGTTAAGAAGGCTTATGACCTTTTGGAATCCACTCCAAATGCCCTTATACTCCAACAATTCTCAAACCCCGCTAATACTCAGGACCTGAGATATGGTGACACCTTTGTAATGGGAATTGGTAGAGGAGGCACCATCTCTTGGGTTGGACAGTATCTCAAATCTCAAAATCCTGATTGTAAGAGATATGGAGTGGAGCCTGGTGAAAGTAATAATATACTAAATGGTGGTAAACCAGGTCCTCATTCGATTACTGGCAATGGGGTTGGATTCAAACCCAATATATTGGACATGGACAAAATGGAAAGAGTACTTGAGCGTATATATGCCTTTTATATGGCTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

12.83

Weight (kDa)

7.82

Isoelectric Point (pI)

37.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 6 - 113 2e-08 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 140
AccB7I CCANNNNNTGG 1 cut(s) 150
AciI CCGC 1 cut(s) 81
AfaI GTAC 1 cut(s) 321
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 1 cut(s) 283
AjnI CCWGG 2 cut(s) 208, 244
AlwNI CAGNNNCTG 1 cut(s) 97
AspS9I GGNCC 2 cut(s) 94, 248
AsuHPI GGTGA 2 cut(s) 119, 224
AvaII GGWCC 2 cut(s) 94, 248
BanI GGYRCC 1 cut(s) 140
BccI CCATC 1 cut(s) 152
BciT130I CCWGG 2 cut(s) 210, 246
BmcAI AGTACT 1 cut(s) 321
Bme1390I CCNGG 2 cut(s) 210, 246
Bme18I GGWCC 2 cut(s) 94, 248
BmgT120I GGNCC 2 cut(s) 94, 248
BmiI GGNNCC 2 cut(s) 142, 207
BmrFI CCNGG 2 cut(s) 210, 246
BpuEI CTTGAG 1 cut(s) 344
BsaXI ACNNNNNCTCC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 150
Bse1I ACTGG 1 cut(s) 268
Bse3DI GCAATG 1 cut(s) 274
BseBI CCWGG 2 cut(s) 210, 246
BseLI CCNNNNNNNGG 1 cut(s) 150
BseMI GCAATG 1 cut(s) 274
BseMII CTCAG 2 cut(s) 89, 104
BseNI ACTGG 1 cut(s) 268
BseRI GAGGAG 1 cut(s) 150
BshNI GGYRCC 1 cut(s) 140
BslI CCNNNNNNNGG 1 cut(s) 150
BspACI CCGC 1 cut(s) 81
BspCNI CTCAG 2 cut(s) 90, 103
BspLI GGNNCC 2 cut(s) 142, 207
BspT107I GGYRCC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 274
BsrI ACTGG 1 cut(s) 268
Bst2UI CCWGG 2 cut(s) 210, 246
Bst4CI ACNGT 2 cut(s) 13, 162
BstDEI CTNAG 2 cut(s) 90, 98
BstNI CCWGG 2 cut(s) 210, 246
BstSCI CCNGG 2 cut(s) 208, 244
BstXI CCANNNNNNTGG 1 cut(s) 295
CaiI CAGNNNCTG 1 cut(s) 97
Cfr13I GGNCC 2 cut(s) 94, 248
CsiI ACCWGGT 1 cut(s) 244
Csp6I GTAC 1 cut(s) 320
CviAII CATG 1 cut(s) 301
CviJI RGCY 3 cut(s) 23, 208, 350
CviKI_1 RGCY 3 cut(s) 23, 208, 350
CviQI GTAC 1 cut(s) 320
DdeI CTNAG 2 cut(s) 90, 98
Eco47I GGWCC 2 cut(s) 94, 248
EcoO109I RGGNCCY 2 cut(s) 94, 248
EcoRII CCWGG 2 cut(s) 208, 244
FaeI CATG 1 cut(s) 304
FatI CATG 1 cut(s) 300
FauI CCCGC 1 cut(s) 88
Hin1II CATG 1 cut(s) 304
HinfI GANTC 2 cut(s) 38, 279
HphI GGTGA 2 cut(s) 119, 224
Hpy166II GTNNAC 1 cut(s) 242
Hpy188III TCNNGA 2 cut(s) 92, 182
Hpy8I GTNNAC 1 cut(s) 242
HpyAV CCTTC 1 cut(s) 13
HpyCH4III ACNGT 2 cut(s) 13, 162
HpyF3I CTNAG 2 cut(s) 90, 98
Hsp92II CATG 1 cut(s) 304
LmnI GCTCC 1 cut(s) 205
LpnPI CCDG 8 cut(s) 77, 110, 195, 195, 222, 231, 249, 258
MabI ACCWGGT 1 cut(s) 244
MaeIII GTNAC 1 cut(s) 107
MluCI AATT 2 cut(s) 68, 126
MmeI TCCRAC 3 cut(s) 88, 136, 256
MnlI CCTC 3 cut(s) 128, 131, 261
MseI TTAA 1 cut(s) 15
MspR9I CCNGG 2 cut(s) 210, 246
MvaI CCWGG 2 cut(s) 210, 246
NlaIII CATG 1 cut(s) 304
NlaIV GGNNCC 2 cut(s) 142, 207
NmuCI GTSAC 1 cut(s) 107
PfeI GAWTC 2 cut(s) 38, 279
PflMI CCANNNNNTGG 1 cut(s) 150
PpuMI RGGWCCY 2 cut(s) 94, 248
Psp5II RGGWCCY 2 cut(s) 94, 248
Psp6I CCWGG 2 cut(s) 208, 244
PspGI CCWGG 2 cut(s) 208, 244
PspN4I GGNNCC 2 cut(s) 142, 207
PspPI GGNCC 2 cut(s) 94, 248
PspPPI RGGWCCY 2 cut(s) 94, 248
PstNI CAGNNNCTG 1 cut(s) 97
RsaI GTAC 1 cut(s) 321
RsaNI GTAC 1 cut(s) 320
SaqAI TTAA 1 cut(s) 15
Sau96I GGNCC 2 cut(s) 94, 248
ScaI AGTACT 1 cut(s) 321
ScrFI CCNGG 2 cut(s) 210, 246
SetI ASST 4 cut(s) 33, 99, 116, 250
SexAI ACCWGGT 1 cut(s) 244
SinI GGWCC 2 cut(s) 94, 248
SmlI CTYRAG 1 cut(s) 323
SmoI CTYRAG 1 cut(s) 323
Sse9I AATT 2 cut(s) 68, 126
SsiI CCGC 1 cut(s) 81
StyD4I CCNGG 2 cut(s) 208, 244
TaaI ACNGT 2 cut(s) 13, 162
TaqI TCGA 1 cut(s) 257
TasI AATT 2 cut(s) 68, 126
TatI WGTACW 1 cut(s) 319
TfiI GAWTC 2 cut(s) 38, 279
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
Van91I CCANNNNNTGG 1 cut(s) 150
VpaK11BI GGWCC 2 cut(s) 94, 248
ZrmI AGTACT 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.