Rh6CG145900

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
19083948 .. 19084818
871 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG145900.1

Sequence Viewer

Length: 282 bp
ATGCTTATACTCTTGAAACTGCTGTTTTATTCATTATGCTCGAAACTACAGGATCTGAGATATGTTGACATCTTTGTAACGGGAATTGGTAGCGGAGGCACCATCTCTGGGGTTGAACAGTATCTCAAATCTCAATACCCTGATTGTAAGATATATGGAGTGGAGCCTGCTGAAAGTAATAATATACTAAATGGTGGTAAACCAGGTAGACCAATGCTTGATTTCATATTTTTTACTGGTTTTACCTTATTTCAAATTCTTTTTTTCCTAAATGCTTTGTAG
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.42

Weight (kDa)

6.08

Isoelectric Point (pI)

28.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 17 - 71 1.7e-10 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 98
AccI GTMKAC 1 cut(s) 208
AciI CCGC 1 cut(s) 93
AclWI GGATC 1 cut(s) 60
AcsI RAATTY 1 cut(s) 255
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 3 cut(s) 16, 116, 254
AjnI CCWGG 1 cut(s) 202
AlwI GGATC 1 cut(s) 60
AlwNI CAGNNNCTG 1 cut(s) 55
ApoI RAATTY 1 cut(s) 255
BanI GGYRCC 1 cut(s) 98
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 204
BmiI GGNNCC 2 cut(s) 100, 165
BmrFI CCNGG 1 cut(s) 204
Bsc4I CCNNNNNNNGG 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 241
BseBI CCWGG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 47
BseNI ACTGG 1 cut(s) 241
BshNI GGYRCC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 108
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 1 cut(s) 93
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 2 cut(s) 100, 165
BspPI GGATC 1 cut(s) 60
BspT107I GGYRCC 1 cut(s) 98
BsrI ACTGG 1 cut(s) 241
BssMI GATC 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 204
Bst4CI ACNGT 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstNI CCWGG 1 cut(s) 204
BstSCI CCNGG 1 cut(s) 202
BstSFI CTRYAG 1 cut(s) 47
BstX2I RGATCY 1 cut(s) 52
BstYI RGATCY 1 cut(s) 52
Cac8I GCNNGC 1 cut(s) 168
CaiI CAGNNNCTG 1 cut(s) 55
CsiI ACCWGGT 1 cut(s) 202
CviJI RGCY 1 cut(s) 166
CviKI_1 RGCY 1 cut(s) 166
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
EcoRII CCWGG 1 cut(s) 202
FaiI YATR 7 cut(s) 8, 37, 63, 154, 156, 185, 227
FblI GTMKAC 1 cut(s) 208
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
Hpy166II GTNNAC 3 cut(s) 67, 200, 209
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 13
Hpy8I GTNNAC 3 cut(s) 67, 200, 209
HpyCH4III ACNGT 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 56
Kzo9I GATC 1 cut(s) 52
LmnI GCTCC 1 cut(s) 163
LpnPI CCDG 7 cut(s) 35, 93, 153, 180, 189, 216, 222
MabI ACCWGGT 1 cut(s) 202
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MflI RGATCY 1 cut(s) 52
MluCI AATT 2 cut(s) 84, 255
MnlI CCTC 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 204
MvaI CCWGG 1 cut(s) 204
NdeII GATC 1 cut(s) 52
NlaIV GGNNCC 2 cut(s) 100, 165
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
PspN4I GGNNCC 2 cut(s) 100, 165
PstNI CAGNNNCTG 1 cut(s) 55
PsuI RGATCY 1 cut(s) 52
Sau3AI GATC 1 cut(s) 52
ScrFI CCNGG 1 cut(s) 204
SetI ASST 2 cut(s) 208, 248
SexAI ACCWGGT 1 cut(s) 202
SfcI CTRYAG 1 cut(s) 47
Sse9I AATT 2 cut(s) 84, 255
SsiI CCGC 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 202
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 1 cut(s) 41
TasI AATT 2 cut(s) 84, 255
TspDTI ATGAA 2 cut(s) 21, 214
XapI RAATTY 1 cut(s) 255
XmiI GTMKAC 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.