Rroxscaffold_1G00026260

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
33065750 .. 33070345
4596 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00026260.1

Sequence Viewer

Length: 297 bp
ATGGGAATTGGTAGCGGAGGCACCATCTCTGGGGTTGGACAGTATCTCAAATCTCAATACCCTGATTGTAAGATATATGGAGTGGAGCCTGCTGAAAGTAATAATATACTAAATGGTGGTAAACCAGGTCCTCATTCGATTACTGGCAATGGGGTTGGATTCAAACCCAATATATTGGACATGGACATAATGGAAAGAGTTCTTGAGGTGAGTAATAGGTCCTCATTCGATTACTGGCAATGGGGTTGGATTCAAACCCAATATATTGGACATGGACATAATGGAAAGAGTTCTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.63

Weight (kDa)

6.24

Isoelectric Point (pI)

23.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 2 - 77 9.5e-11 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 20
AciI CCGC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 30
AgsI TTSAA 2 cut(s) 163, 254
AjnI CCWGG 1 cut(s) 124
Asp700I GAANNNNTTC 2 cut(s) 198, 289
AspS9I GGNCC 2 cut(s) 128, 219
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 2 cut(s) 128, 219
BanI GGYRCC 1 cut(s) 20
BccI CCATC 1 cut(s) 32
BciT130I CCWGG 1 cut(s) 126
Bme1390I CCNGG 1 cut(s) 126
Bme18I GGWCC 2 cut(s) 128, 219
BmgT120I GGNCC 2 cut(s) 128, 219
BmiI GGNNCC 2 cut(s) 22, 87
BmrFI CCNGG 1 cut(s) 126
BpuEI CTTGAG 1 cut(s) 224
Bsc4I CCNNNNNNNGG 1 cut(s) 30
Bse1I ACTGG 2 cut(s) 148, 239
Bse3DI GCAATG 2 cut(s) 154, 245
BseBI CCWGG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 30
BseMI GCAATG 2 cut(s) 154, 245
BseNI ACTGG 2 cut(s) 148, 239
BshNI GGYRCC 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 30
BspACI CCGC 1 cut(s) 15
BspLI GGNNCC 2 cut(s) 22, 87
BspT107I GGYRCC 1 cut(s) 20
BsrDI GCAATG 2 cut(s) 154, 245
BsrI ACTGG 2 cut(s) 148, 239
Bst2UI CCWGG 1 cut(s) 126
Bst4CI ACNGT 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 90
BstNI CCWGG 1 cut(s) 126
BstSCI CCNGG 1 cut(s) 124
BstXI CCANNNNNNTGG 2 cut(s) 175, 266
Cac8I GCNNGC 1 cut(s) 90
Cfr13I GGNCC 2 cut(s) 128, 219
CsiI ACCWGGT 1 cut(s) 124
CviAII CATG 2 cut(s) 181, 272
CviJI RGCY 1 cut(s) 88
CviKI_1 RGCY 1 cut(s) 88
Eco47I GGWCC 2 cut(s) 128, 219
EcoO109I RGGNCCY 2 cut(s) 128, 219
EcoRII CCWGG 1 cut(s) 124
FaeI CATG 2 cut(s) 184, 275
FaiI YATR 9 cut(s) 76, 78, 107, 173, 182, 188, 264, 273, 279
FatI CATG 2 cut(s) 180, 271
Hin1II CATG 2 cut(s) 184, 275
HinfI GANTC 2 cut(s) 159, 250
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 122
Hpy188III TCNNGA 2 cut(s) 203, 294
Hpy8I GTNNAC 1 cut(s) 122
HpyCH4III ACNGT 1 cut(s) 42
Hsp92II CATG 2 cut(s) 184, 275
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 7 cut(s) 15, 75, 102, 111, 129, 138, 220
MabI ACCWGGT 1 cut(s) 124
MluCI AATT 1 cut(s) 6
MmeI TCCRAC 3 cut(s) 16, 136, 227
MnlI CCTC 4 cut(s) 11, 141, 199, 232
MroXI GAANNNNTTC 2 cut(s) 198, 289
MspR9I CCNGG 1 cut(s) 126
MvaI CCWGG 1 cut(s) 126
NlaIII CATG 2 cut(s) 184, 275
NlaIV GGNNCC 2 cut(s) 22, 87
PdmI GAANNNNTTC 2 cut(s) 198, 289
PfeI GAWTC 2 cut(s) 159, 250
PpuMI RGGWCCY 2 cut(s) 128, 219
Psp5II RGGWCCY 2 cut(s) 128, 219
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
PspN4I GGNNCC 2 cut(s) 22, 87
PspPI GGNCC 2 cut(s) 128, 219
PspPPI RGGWCCY 2 cut(s) 128, 219
Sau96I GGNCC 2 cut(s) 128, 219
ScrFI CCNGG 1 cut(s) 126
SetI ASST 3 cut(s) 130, 210, 221
SexAI ACCWGGT 1 cut(s) 124
SinI GGWCC 2 cut(s) 128, 219
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 1 cut(s) 6
SsiI CCGC 1 cut(s) 15
StyD4I CCNGG 1 cut(s) 124
TaaI ACNGT 1 cut(s) 42
TaqI TCGA 2 cut(s) 137, 228
TasI AATT 1 cut(s) 6
TfiI GAWTC 2 cut(s) 159, 250
VpaK11BI GGWCC 2 cut(s) 128, 219
XmnI GAANNNNTTC 2 cut(s) 198, 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.