Rh5DG268500

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
32542169 .. 32547361
5193 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG268500.1

Sequence Viewer

Length: 324 bp
ATGCTTATACTCTTGAAACTGCTGTTTTATTCAGTATGCTCGAAACTACAGGATCTGAGATATGGTGACATCTTTGTAACGGGAATTGGTAGCGGAGGCACCATCTCTGGGGTTGGACAGTATCTCAAATCTCAAAACCCTGATTGTAAGATATATGGAGTGGAGCCTGCTGAAAGTAATAATATACTAAATGGCGGTAAACCAGGTCCTCATTCGATTACTAGCAATGGGGTTGGATTCAAACCCAATATATTGGGCATGTTGAGCTACTTTGTATATGTGATTTTGCTGACAAAGTCTTCAACAGTGGTGGCAACTCTTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.4

Weight (kDa)

8.95

Isoelectric Point (pI)

26.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PALP PF00291 23 - 71 2.1e-10 Pyridoxal-phosphate dependent enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 98
AciI CCGC 2 cut(s) 93, 195
AclWI GGATC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 3 cut(s) 16, 241, 303
AjnI CCWGG 1 cut(s) 202
AluBI AGCT 1 cut(s) 267
AluI AGCT 1 cut(s) 267
AlwI GGATC 1 cut(s) 60
AlwNI CAGNNNCTG 1 cut(s) 55
AspS9I GGNCC 1 cut(s) 206
AsuHPI GGTGA 1 cut(s) 77
AvaII GGWCC 1 cut(s) 206
BanI GGYRCC 1 cut(s) 98
BbsI GAAGAC 1 cut(s) 291
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 204
BfaI CTAG 1 cut(s) 222
BfmI CTRYAG 1 cut(s) 47
Bme1390I CCNGG 1 cut(s) 204
Bme18I GGWCC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 206
BmiI GGNNCC 2 cut(s) 100, 165
BmrFI CCNGG 1 cut(s) 204
BpiI GAAGAC 1 cut(s) 291
Bsc4I CCNNNNNNNGG 1 cut(s) 108
Bse3DI GCAATG 1 cut(s) 232
BseBI CCWGG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 232
BseMII CTCAG 1 cut(s) 47
BshNI GGYRCC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 108
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 2 cut(s) 93, 195
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 2 cut(s) 100, 165
BspPI GGATC 1 cut(s) 60
BspT107I GGYRCC 1 cut(s) 98
BsrDI GCAATG 1 cut(s) 232
BssMI GATC 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 204
Bst4CI ACNGT 2 cut(s) 120, 307
BstC8I GCNNGC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 56
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstMWI GCNNNNNNNGC 1 cut(s) 264
BstNI CCWGG 1 cut(s) 204
BstNSI RCATGY 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 202
BstSFI CTRYAG 1 cut(s) 47
BstV2I GAAGAC 1 cut(s) 291
BstX2I RGATCY 1 cut(s) 52
BstXI CCANNNNNNTGG 1 cut(s) 253
BstYI RGATCY 1 cut(s) 52
BtsIMutI CAGTG 1 cut(s) 312
Cac8I GCNNGC 1 cut(s) 168
CaiI CAGNNNCTG 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 206
CsiI ACCWGGT 1 cut(s) 202
CspCI CAANNNNNGTGG 1 cut(s) 291
CviAII CATG 1 cut(s) 259
CviJI RGCY 2 cut(s) 166, 267
CviKI_1 RGCY 2 cut(s) 166, 267
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 206
EcoO109I RGGNCCY 1 cut(s) 206
EcoRII CCWGG 1 cut(s) 202
FaeI CATG 1 cut(s) 262
FatI CATG 1 cut(s) 258
FspBI CTAG 1 cut(s) 222
Hin1II CATG 1 cut(s) 262
HinfI GANTC 1 cut(s) 237
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 200
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 200
HpyCH4III ACNGT 2 cut(s) 120, 307
HpyF10VI GCNNNNNNNGC 1 cut(s) 264
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 1 cut(s) 262
Kzo9I GATC 1 cut(s) 52
LmnI GCTCC 1 cut(s) 163
LpnPI CCDG 6 cut(s) 35, 93, 153, 180, 189, 216
MabI ACCWGGT 1 cut(s) 202
MaeI CTAG 1 cut(s) 222
MaeIII GTNAC 2 cut(s) 65, 76
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 1 cut(s) 291
MflI RGATCY 1 cut(s) 52
MluCI AATT 1 cut(s) 84
MmeI TCCRAC 2 cut(s) 94, 214
MnlI CCTC 2 cut(s) 89, 219
MspR9I CCNGG 1 cut(s) 204
MvaI CCWGG 1 cut(s) 204
MwoI GCNNNNNNNGC 1 cut(s) 264
NdeII GATC 1 cut(s) 52
NlaIII CATG 1 cut(s) 262
NlaIV GGNNCC 2 cut(s) 100, 165
NmuCI GTSAC 1 cut(s) 65
NspI RCATGY 1 cut(s) 262
PfeI GAWTC 1 cut(s) 237
PflFI GACNNNGTC 1 cut(s) 295
PpuMI RGGWCCY 1 cut(s) 206
Psp5II RGGWCCY 1 cut(s) 206
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
PspN4I GGNNCC 2 cut(s) 100, 165
PspPI GGNCC 1 cut(s) 206
PspPPI RGGWCCY 1 cut(s) 206
PstNI CAGNNNCTG 1 cut(s) 55
PsuI RGATCY 1 cut(s) 52
PsyI GACNNNGTC 1 cut(s) 295
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 206
ScrFI CCNGG 1 cut(s) 204
SetI ASST 2 cut(s) 208, 269
SexAI ACCWGGT 1 cut(s) 202
SfcI CTRYAG 1 cut(s) 47
SinI GGWCC 1 cut(s) 206
Sse9I AATT 1 cut(s) 84
SsiI CCGC 2 cut(s) 93, 195
SspMI CTAG 1 cut(s) 222
StyD4I CCNGG 1 cut(s) 202
TaaI ACNGT 2 cut(s) 120, 307
TaqI TCGA 2 cut(s) 41, 215
TasI AATT 1 cut(s) 84
TfiI GAWTC 1 cut(s) 237
TscAI CASTG 1 cut(s) 312
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
TspRI CASTG 1 cut(s) 312
Tth111I GACNNNGTC 1 cut(s) 295
VpaK11BI GGWCC 1 cut(s) 206
XceI RCATGY 1 cut(s) 262
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.