RchiOBHm_Chr1g0327551

Belongs to the cysteine synthase cystathionine beta- synthase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
16432227 .. 16432815
589 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
ATGACAGTATCTCAAACTCAAAACCCTGATTGTAAGATATATGGAGTGGAGCTTGTTGAAAGTAATAATATACTAAATGGTGGTAAACCAGGTCCTCATTCGATTACTGGAAATGGGGTTGGATTCAAACCCAATATATTGGACATGCACATAATGGAAAGAGTTCTTGAGGTGAGTATCAAATATGTATATAGCATATGTGTGCCTTTTATATGGCTTTCTAAAGAGTCCATTTTTATTGATTTTGTTTACTTACATTTCGTATTTTGTAACTCCCAAATATAA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.63

Weight (kDa)

5.81

Isoelectric Point (pI)

29.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 59, 127
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
Asp700I GAANNNNTTC 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 92
AsuHPI GGTGA 1 cut(s) 184
AvaII GGWCC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 90
BpuEI CTTGAG 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 112
BseBI CCWGG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 112
BsrI ACTGG 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 7
BstNI CCWGG 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 148
BstSCI CCNGG 1 cut(s) 88
BstXI CCANNNNNNTGG 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 92
CsiI ACCWGGT 1 cut(s) 88
CviAII CATG 1 cut(s) 145
CviJI RGCY 2 cut(s) 52, 217
CviKI_1 RGCY 2 cut(s) 52, 217
Eco47I GGWCC 1 cut(s) 92
EcoO109I RGGNCCY 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 88
FaeI CATG 1 cut(s) 148
FatI CATG 1 cut(s) 144
FauNDI CATATG 1 cut(s) 197
Hin1II CATG 1 cut(s) 148
HinfI GANTC 2 cut(s) 123, 227
HphI GGTGA 1 cut(s) 184
Hpy166II GTNNAC 2 cut(s) 86, 250
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 2 cut(s) 86, 250
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 148
Hsp92II CATG 1 cut(s) 148
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 4 cut(s) 39, 75, 93, 102
MabI ACCWGGT 1 cut(s) 88
MaeIII GTNAC 1 cut(s) 269
MlyI GAGTC 1 cut(s) 236
MmeI TCCRAC 1 cut(s) 100
MnlI CCTC 2 cut(s) 105, 163
MroXI GAANNNNTTC 1 cut(s) 162
MslI CAYNNNNRTG 1 cut(s) 200
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
NdeI CATATG 1 cut(s) 197
NlaIII CATG 1 cut(s) 148
NspI RCATGY 1 cut(s) 148
PdmI GAANNNNTTC 1 cut(s) 162
PfeI GAWTC 1 cut(s) 123
PleI GAGTC 1 cut(s) 235
PpsI GAGTC 1 cut(s) 235
PpuMI RGGWCCY 1 cut(s) 92
Psp5II RGGWCCY 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
PspPI GGNCC 1 cut(s) 92
PspPPI RGGWCCY 1 cut(s) 92
RseI CAYNNNNRTG 1 cut(s) 200
Sau96I GGNCC 1 cut(s) 92
SchI GAGTC 1 cut(s) 236
ScrFI CCNGG 1 cut(s) 90
SetI ASST 3 cut(s) 54, 94, 174
SexAI ACCWGGT 1 cut(s) 88
SgeI CNNG 7 cut(s) 38, 65, 101, 102, 120, 157, 179
SinI GGWCC 1 cut(s) 92
SmiMI CAYNNNNRTG 1 cut(s) 200
SmlI CTYRAG 1 cut(s) 167
SmoI CTYRAG 1 cut(s) 167
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 7
TaqI TCGA 1 cut(s) 101
TfiI GAWTC 1 cut(s) 123
VpaK11BI GGWCC 1 cut(s) 92
XceI RCATGY 1 cut(s) 148
XmnI GAANNNNTTC 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.