RchiOBHm_Chr1g0381081

Ribonucleoside-diphosphate reductase small chain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
66461976 .. 66463135
1160 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 123 bp
ATGTTTCCCGTCAGGTACCAGCAACTTTGGGAGATGTACAACAAGGCTAAGGCTAGTTTTTGGACTGCTGAGGAGGTTGATCTCTCCCAGGATGTACAACAATGGGACTGTGGGAGGCTCTGA

Protein Analysis

40

Amino Acids

4.9

Weight (kDa)

4.59

Isoelectric Point (pI)

55.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribonuc_red_sm PF00268 1 - 36 4.7e-13 Ribonucleotide reductase, small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 15
AccB1I GGYRCC 1 cut(s) 15
AfaI GTAC 3 cut(s) 17, 38, 96
AjnI CCWGG 1 cut(s) 87
Asp718I GGTACC 1 cut(s) 15
BanI GGYRCC 1 cut(s) 15
BbvCI CCTCAGC 1 cut(s) 69
BciT130I CCWGG 1 cut(s) 89
BfaI CTAG 1 cut(s) 54
Bme1390I CCNGG 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 89
Bpu10I CCTNAGC 2 cut(s) 48, 69
BsaJI CCNNGG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 87
BseGI GGATG 1 cut(s) 97
BseMII CTCAG 1 cut(s) 60
BseRI GAGGAG 1 cut(s) 86
BshNI GGYRCC 1 cut(s) 15
BslFI GGGAC 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 119
Bsp1407I TGTACA 2 cut(s) 36, 94
Bsp143I GATC 1 cut(s) 79
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 17
BspT107I GGYRCC 1 cut(s) 15
BsrGI TGTACA 2 cut(s) 36, 94
BssECI CCNNGG 1 cut(s) 87
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 89
Bst4CI ACNGT 1 cut(s) 110
BstAUI TGTACA 2 cut(s) 36, 94
BstDEI CTNAG 2 cut(s) 48, 69
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 87
BtsCI GGATG 1 cut(s) 97
Csp6I GTAC 3 cut(s) 16, 37, 95
CviJI RGCY 3 cut(s) 47, 53, 118
CviKI_1 RGCY 3 cut(s) 47, 53, 118
CviQI GTAC 3 cut(s) 16, 37, 95
DdeI CTNAG 2 cut(s) 48, 69
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 87
FaqI GGGAC 1 cut(s) 119
FokI GGATG 1 cut(s) 104
FspBI CTAG 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 122
HpyCH4III ACNGT 1 cut(s) 110
HpyF3I CTNAG 2 cut(s) 48, 69
KpnI GGTACC 1 cut(s) 19
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 3 cut(s) 32, 74, 101
MaeI CTAG 1 cut(s) 54
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MnlI CCTC 3 cut(s) 64, 67, 108
MspR9I CCNGG 1 cut(s) 89
MvaI CCWGG 1 cut(s) 89
NdeII GATC 1 cut(s) 79
NlaIV GGNNCC 1 cut(s) 17
Psp6I CCWGG 1 cut(s) 87
PspGI CCWGG 1 cut(s) 87
PspN4I GGNNCC 1 cut(s) 17
RsaI GTAC 3 cut(s) 17, 38, 96
RsaNI GTAC 3 cut(s) 16, 37, 95
Sau3AI GATC 1 cut(s) 79
ScrFI CCNGG 1 cut(s) 89
SetI ASST 2 cut(s) 17, 78
SgeI CNNG 7 cut(s) 20, 25, 31, 55, 66, 100, 101
SspMI CTAG 1 cut(s) 54
StyD4I CCNGG 1 cut(s) 87
TaaI ACNGT 1 cut(s) 110
TatI WGTACW 2 cut(s) 36, 94
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.