Rroxscaffold_2G00140440
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
78654170 .. 78657022
2853 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00140440.1

Sequence Viewer

Length: 207 bp
ATGCACACAAACATGATGGTTTATAGGCTGTATGCCTATTCTTTTGTACATTTGGAAATGAAGTTCGAGTATGGCATAGGAATGGAGGTGTCAACAAGTGGTGACACCTATAGCTATGAAATCCTGCTATTTGAGATGCTGATAAGCAAGAGATTGACATATGACATGTTTAAAGACGGCCTGAACTTGAATAAATTTGTTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

68

Amino Acids

8.16

Weight (kDa)

6.03

Isoelectric Point (pI)

23.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 194
AfaI GTAC 1 cut(s) 48
AflIII ACRYGT 1 cut(s) 165
AgsI TTSAA 1 cut(s) 190
AloI GAACNNNNNNTCC 2 cut(s) 47, 79
AluBI AGCT 1 cut(s) 114
AluI AGCT 1 cut(s) 114
AoxI GGCC 1 cut(s) 178
ApoI RAATTY 1 cut(s) 194
AsuHPI GGTGA 1 cut(s) 113
BccI CCATC 1 cut(s) 10
BceAI ACGGC 1 cut(s) 193
BfmI CTRYAG 1 cut(s) 109
BmsI GCATC 1 cut(s) 126
BshFI GGCC 1 cut(s) 180
BsnI GGCC 1 cut(s) 180
Bsp1407I TGTACA 1 cut(s) 46
BspANI GGCC 1 cut(s) 180
BsrGI TGTACA 1 cut(s) 46
BstAUI TGTACA 1 cut(s) 46
BstNSI RCATGY 1 cut(s) 169
BstSFI CTRYAG 1 cut(s) 109
BsuRI GGCC 1 cut(s) 180
Csp6I GTAC 1 cut(s) 47
CviAII CATG 2 cut(s) 13, 166
CviJI RGCY 3 cut(s) 28, 114, 180
CviKI_1 RGCY 3 cut(s) 28, 114, 180
CviQI GTAC 1 cut(s) 47
DraI TTTAAA 1 cut(s) 172
FaeI CATG 2 cut(s) 16, 169
FatI CATG 2 cut(s) 12, 165
FauNDI CATATG 1 cut(s) 160
HaeIII GGCC 1 cut(s) 180
Hin1II CATG 2 cut(s) 16, 169
HincII GTYRAC 1 cut(s) 93
HindII GTYRAC 1 cut(s) 93
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 93
Hpy8I GTNNAC 1 cut(s) 93
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 2 cut(s) 16, 169
LpnPI CCDG 2 cut(s) 137, 194
LweI GCATC 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 101
MluCI AATT 1 cut(s) 194
MnlI CCTC 1 cut(s) 79
MseI TTAA 2 cut(s) 171, 201
MslI CAYNNNNRTG 2 cut(s) 11, 80
NdeI CATATG 1 cut(s) 160
NlaIII CATG 2 cut(s) 16, 169
NmuCI GTSAC 1 cut(s) 101
NspI RCATGY 1 cut(s) 169
PciI ACATGT 1 cut(s) 165
PscI ACATGT 1 cut(s) 165
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
RseI CAYNNNNRTG 2 cut(s) 11, 80
SaqAI TTAA 2 cut(s) 171, 201
SetI ASST 3 cut(s) 90, 110, 116
SfaNI GCATC 1 cut(s) 126
SfcI CTRYAG 1 cut(s) 109
SgeI CNNG 8 cut(s) 25, 79, 108, 136, 160, 178, 193, 199
SmiMI CAYNNNNRTG 2 cut(s) 11, 80
Sse9I AATT 1 cut(s) 194
TaqI TCGA 1 cut(s) 66
TasI AATT 1 cut(s) 194
TatI WGTACW 1 cut(s) 46
Tru1I TTAA 2 cut(s) 171, 201
Tru9I TTAA 2 cut(s) 171, 201
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 74, 132
XapI RAATTY 1 cut(s) 194
XceI RCATGY 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.