RchiOBHm_Chr5g0063681

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
69342657 .. 69343826
1170 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33975

Sequence Viewer

Length: 165 bp
ATGTCCAGTACTTGGCGATTACTGTCGCCTCAATATGAATTTCGATTGATTTGGAAATTGGCATCGTTTTGGTTAGCTTTTGCCTGTTGCTTTTTATGGTTGTTTTCTGCAACAAGTATTACTTTTGGTAAATTATGTTGGGATTCAGGTTTTGGTTATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.38

Weight (kDa)

8.61

Isoelectric Point (pI)

48.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 12
AcsI RAATTY 1 cut(s) 38
AfaI GTAC 1 cut(s) 10
AfiI CCNNNNNNNGG 1 cut(s) 12
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
ApoI RAATTY 1 cut(s) 38
BmcAI AGTACT 1 cut(s) 10
BmsI GCATC 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 6
BseLI CCNNNNNNNGG 1 cut(s) 12
BseNI ACTGG 1 cut(s) 6
BslI CCNNNNNNNGG 1 cut(s) 12
BsrI ACTGG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 24
Csp6I GTAC 1 cut(s) 9
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
CviQI GTAC 1 cut(s) 9
FaiI YATR 4 cut(s) 36, 97, 136, 159
FalI AAGNNNNNCTT 2 cut(s) 106, 138
HinfI GANTC 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 110
LpnPI CCDG 3 cut(s) 19, 97, 132
LweI GCATC 1 cut(s) 71
MluCI AATT 3 cut(s) 38, 56, 131
MnlI CCTC 1 cut(s) 39
PfeI GAWTC 1 cut(s) 143
PflMI CCANNNNNTGG 1 cut(s) 12
RsaI GTAC 1 cut(s) 10
RsaNI GTAC 1 cut(s) 9
ScaI AGTACT 1 cut(s) 10
SetI ASST 2 cut(s) 79, 151
SfaNI GCATC 1 cut(s) 71
SgeI CNNG 5 cut(s) 18, 24, 96, 126, 159
Sse9I AATT 3 cut(s) 38, 56, 131
TaaI ACNGT 1 cut(s) 24
TaqI TCGA 1 cut(s) 43
TasI AATT 3 cut(s) 38, 56, 131
TatI WGTACW 1 cut(s) 8
TfiI GAWTC 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 51
Van91I CCANNNNNTGG 1 cut(s) 12
XapI RAATTY 1 cut(s) 38
ZrmI AGTACT 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.